ID: 974052349

View in Genome Browser
Species Human (GRCh38)
Location 4:56952704-56952726
Sequence CCTGGGAAGTCTCTGTAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974052349_974052359 29 Left 974052349 4:56952704-56952726 CCCCATTACAGAGACTTCCCAGG No data
Right 974052359 4:56952756-56952778 AGTATAAGTACTGGAGCTAGAGG No data
974052349_974052360 30 Left 974052349 4:56952704-56952726 CCCCATTACAGAGACTTCCCAGG No data
Right 974052360 4:56952757-56952779 GTATAAGTACTGGAGCTAGAGGG No data
974052349_974052354 -7 Left 974052349 4:56952704-56952726 CCCCATTACAGAGACTTCCCAGG No data
Right 974052354 4:56952720-56952742 TCCCAGGTAGAGGACTTCCTAGG No data
974052349_974052358 20 Left 974052349 4:56952704-56952726 CCCCATTACAGAGACTTCCCAGG No data
Right 974052358 4:56952747-56952769 CTTTCTTCTAGTATAAGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974052349 Original CRISPR CCTGGGAAGTCTCTGTAATG GGG (reversed) Intergenic
No off target data available for this crispr