ID: 974060043

View in Genome Browser
Species Human (GRCh38)
Location 4:57024602-57024624
Sequence TTCAAATAGAAGTCGATCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 61}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974060043 Original CRISPR TTCAAATAGAAGTCGATCCA TGG (reversed) Intronic
901192882 1:7422900-7422922 TTCAAATACAAATCCATCAAAGG - Intronic
904288665 1:29470025-29470047 TTCAACTTGAAGTTGATCCGGGG + Intergenic
904530278 1:31164144-31164166 TTCAAATAGCAGTAGCTGCAGGG + Intergenic
906124709 1:43420677-43420699 TTCAGATAGAACTCGATCCCAGG + Intronic
908306082 1:62818285-62818307 TTAAAATAGAAGTCTGACCATGG - Intronic
911046057 1:93629338-93629360 TTCAAATACAAGTTGTTCCCAGG + Intronic
919147895 1:193658051-193658073 TTAAAATAGTAGACCATCCAAGG - Intergenic
919418787 1:197345000-197345022 TTCAAATTGAAGTCTATCATTGG + Intronic
1079807046 11:24945114-24945136 GGCAAATAGAAGTCTATTCAGGG - Intronic
1080110235 11:28558655-28558677 TTCACATAGAAGTAAATCCAAGG + Intergenic
1089866269 11:121634923-121634945 TTTAACTAGAAATGGATCCAGGG - Intergenic
1091159015 11:133402547-133402569 TTCAAAGAGATGCTGATCCAAGG - Intronic
1101611193 12:106293659-106293681 GACAAATAGAAGTCAATCCAAGG - Intronic
1105273317 13:18898454-18898476 TAAAAATATAAGTAGATCCATGG + Intergenic
1110952094 13:81507645-81507667 TCCAAAAAGAAATTGATCCATGG - Intergenic
1111718042 13:91905451-91905473 TACAAAAAGAAGTGGGTCCAAGG + Intronic
1114363484 14:22002178-22002200 TTCATTTAGGAGTAGATCCAGGG - Intergenic
1115601989 14:34964086-34964108 TTCAAGTAGAAATAAATCCATGG - Intergenic
1117463091 14:55966071-55966093 TACAAATAGAAGTTGATTAATGG - Intergenic
1119753104 14:77094700-77094722 TTCAAATAAAACTCGGCCCATGG + Intergenic
1120689272 14:87574859-87574881 TCTAAATAGAAGTATATCCAGGG + Intergenic
1128365254 15:66995341-66995363 AGCAAATGGAAGTCAATCCATGG - Intergenic
1135502092 16:23005094-23005116 TTCAGGTATAGGTCGATCCAGGG - Intergenic
1139107435 16:63844032-63844054 TTCAAAAAAAAGTCAATTCATGG + Intergenic
1143941997 17:10551919-10551941 TTCAATTTTAAGTCAATCCATGG + Intergenic
1150494332 17:65595722-65595744 TTCAAGTAGAAGTTCCTCCAGGG - Intronic
926233360 2:11021447-11021469 CTCAGACAGAAGTCTATCCAGGG + Intergenic
928610713 2:32989531-32989553 TCCAAGTAGAATTTGATCCACGG - Intronic
933067225 2:77812757-77812779 TTCAAGTAGAAGTTGATTTAAGG + Intergenic
934068752 2:88364479-88364501 TTAAAAAAGAAGAGGATCCAAGG + Intergenic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
940714460 2:157204311-157204333 TTCTAATAGCAGTGGAGCCAAGG - Intergenic
947730384 2:232425670-232425692 TTCTAATAGCAGTCCTTCCATGG - Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
950279748 3:11696641-11696663 TTTAAATAGAAGTTGAGTCATGG - Intronic
955617187 3:60821742-60821764 TACAAATAGAAGTCGAAAGAGGG + Intronic
967610624 3:191501789-191501811 ATAGAATAGAAGTAGATCCAAGG + Intergenic
972972219 4:44591708-44591730 TACAAATGGAACTTGATCCAAGG - Intergenic
974060043 4:57024602-57024624 TTCAAATAGAAGTCGATCCATGG - Intronic
976843692 4:89462109-89462131 GACAAATAGAAATGGATCCATGG - Intergenic
978814866 4:112892649-112892671 TTCTAATAGCAGTACATCCAAGG - Intronic
983479983 4:168260906-168260928 TTCAACTAGAAGTGGAAACATGG + Exonic
985170271 4:187141633-187141655 TTAAAATATAAGAAGATCCACGG + Intergenic
985193263 4:187400816-187400838 TTCACAGAGAAGTCAATGCAGGG - Intergenic
989148487 5:38272980-38273002 TTCAAATAGATGTTTATGCAGGG - Intronic
991955000 5:71985547-71985569 TTCAAATACAATTAGATACAGGG + Intergenic
992243792 5:74796745-74796767 TTCTAATAGAATAAGATCCATGG - Intronic
992322800 5:75630152-75630174 TTCAAATAGGCCTCTATCCAGGG - Intronic
997980581 5:138465450-138465472 TTCAAATAGAGGCGGATCCGGGG + Intergenic
1006091704 6:31632298-31632320 TTGAAAGAGAAGTTGATCCCAGG + Exonic
1011583087 6:88893738-88893760 TTAAAAAAGAAGTTGATGCATGG - Intronic
1011812007 6:91143486-91143508 TTGAAGTACAAGTCAATCCATGG - Intergenic
1012777444 6:103515902-103515924 ATCAAATAGAAAAGGATCCATGG - Intergenic
1016366343 6:143322574-143322596 TTCAAATTGAATTCTCTCCAGGG + Intronic
1020530184 7:9323235-9323257 ATCAAATAGAACTCCATGCAGGG - Intergenic
1020992554 7:15218874-15218896 TTGAAAGAGAAGTCCATCTATGG + Intronic
1024658182 7:51469798-51469820 TTCAAATAGAAGCAGATTCAAGG - Intergenic
1032679700 7:134168913-134168935 TTCCAAGAGAAGTGGCTCCATGG - Intronic
1036009300 8:4703317-4703339 TTCAAATATACGTCGCTCCACGG + Intronic
1038613741 8:29074700-29074722 TTCAGATAGAAGTAAATTCACGG + Intronic
1046258497 8:111733494-111733516 TTAAAAAATAAGTCTATCCATGG - Intergenic
1046610483 8:116417948-116417970 TTCAGATAGAAGTAAATCCATGG - Intergenic
1048386642 8:133918415-133918437 TTAAAATAGAAGGAAATCCAAGG - Intergenic
1050766192 9:9137577-9137599 TTCATAAAGAAGTTCATCCATGG - Intronic
1060127140 9:121059063-121059085 TTCAAATACAAATTTATCCACGG - Intergenic
1186314944 X:8359086-8359108 TTCTAATAGAACTACATCCAGGG + Intergenic
1187105559 X:16237931-16237953 TTCAAATAAAGGCCAATCCAGGG + Intergenic
1189699250 X:43699860-43699882 TTCTAATAGAATTTGACCCATGG + Intronic
1197675308 X:129323548-129323570 TTAAAATAGAATTCTATCCCAGG - Intergenic