ID: 974062974

View in Genome Browser
Species Human (GRCh38)
Location 4:57052316-57052338
Sequence CAGGGGTGTCAGTCTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974062969_974062974 -5 Left 974062969 4:57052298-57052320 CCGCACCATGAACAGAAGCAGGG 0: 1
1: 0
2: 1
3: 17
4: 224
Right 974062974 4:57052316-57052338 CAGGGGTGTCAGTCTGAGGAAGG No data
974062967_974062974 6 Left 974062967 4:57052287-57052309 CCAGGAGGCTGCCGCACCATGAA 0: 1
1: 0
2: 0
3: 8
4: 119
Right 974062974 4:57052316-57052338 CAGGGGTGTCAGTCTGAGGAAGG No data
974062966_974062974 17 Left 974062966 4:57052276-57052298 CCTCAAAGGTTCCAGGAGGCTGC 0: 1
1: 0
2: 4
3: 9
4: 179
Right 974062974 4:57052316-57052338 CAGGGGTGTCAGTCTGAGGAAGG No data
974062972_974062974 -10 Left 974062972 4:57052303-57052325 CCATGAACAGAAGCAGGGGTGTC 0: 1
1: 0
2: 1
3: 13
4: 195
Right 974062974 4:57052316-57052338 CAGGGGTGTCAGTCTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974062974 Original CRISPR CAGGGGTGTCAGTCTGAGGA AGG Intronic
No off target data available for this crispr