ID: 974071416

View in Genome Browser
Species Human (GRCh38)
Location 4:57127595-57127617
Sequence GTCCCAGCCAGGGCTAAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974071406_974071416 16 Left 974071406 4:57127556-57127578 CCTTGCTGCTTTGTGCAATCTTG 0: 4
1: 59
2: 107
3: 222
4: 488
Right 974071416 4:57127595-57127617 GTCCCAGCCAGGGCTAAAAGGGG No data
974071405_974071416 22 Left 974071405 4:57127550-57127572 CCAGTGCCTTGCTGCTTTGTGCA 0: 5
1: 119
2: 183
3: 256
4: 670
Right 974071416 4:57127595-57127617 GTCCCAGCCAGGGCTAAAAGGGG No data
974071404_974071416 23 Left 974071404 4:57127549-57127571 CCCAGTGCCTTGCTGCTTTGTGC 0: 3
1: 110
2: 160
3: 231
4: 545
Right 974071416 4:57127595-57127617 GTCCCAGCCAGGGCTAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974071416 Original CRISPR GTCCCAGCCAGGGCTAAAAG GGG Intergenic
No off target data available for this crispr