ID: 974074115

View in Genome Browser
Species Human (GRCh38)
Location 4:57153336-57153358
Sequence TAGAGTGTCCAGGGCCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974074110_974074115 30 Left 974074110 4:57153283-57153305 CCAGTCAGTGTCTCATTTGATTT No data
Right 974074115 4:57153336-57153358 TAGAGTGTCCAGGGCCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974074115 Original CRISPR TAGAGTGTCCAGGGCCATGA AGG Intergenic
No off target data available for this crispr