ID: 974075352

View in Genome Browser
Species Human (GRCh38)
Location 4:57163885-57163907
Sequence TCCAGATGGTCCGCACCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974075346_974075352 3 Left 974075346 4:57163859-57163881 CCTGATGCCTACTATGCCGCGCC No data
Right 974075352 4:57163885-57163907 TCCAGATGGTCCGCACCTGGCGG No data
974075347_974075352 -4 Left 974075347 4:57163866-57163888 CCTACTATGCCGCGCCATCTCCA No data
Right 974075352 4:57163885-57163907 TCCAGATGGTCCGCACCTGGCGG No data
974075345_974075352 4 Left 974075345 4:57163858-57163880 CCCTGATGCCTACTATGCCGCGC No data
Right 974075352 4:57163885-57163907 TCCAGATGGTCCGCACCTGGCGG No data
974075344_974075352 7 Left 974075344 4:57163855-57163877 CCGCCCTGATGCCTACTATGCCG No data
Right 974075352 4:57163885-57163907 TCCAGATGGTCCGCACCTGGCGG No data
974075343_974075352 13 Left 974075343 4:57163849-57163871 CCGGCGCCGCCCTGATGCCTACT No data
Right 974075352 4:57163885-57163907 TCCAGATGGTCCGCACCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974075352 Original CRISPR TCCAGATGGTCCGCACCTGG CGG Intergenic
No off target data available for this crispr