ID: 974076124

View in Genome Browser
Species Human (GRCh38)
Location 4:57170153-57170175
Sequence GAGGTCAAACTGATGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974076118_974076124 6 Left 974076118 4:57170124-57170146 CCTTAGCTGCTGAGGCTGCAGCT No data
Right 974076124 4:57170153-57170175 GAGGTCAAACTGATGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974076124 Original CRISPR GAGGTCAAACTGATGGAGCA TGG Intergenic
No off target data available for this crispr