ID: 974076935

View in Genome Browser
Species Human (GRCh38)
Location 4:57175736-57175758
Sequence TTGGATTTACCAACAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974076935_974076939 4 Left 974076935 4:57175736-57175758 CCTGTCTTTGTTGGTAAATCCAA No data
Right 974076939 4:57175763-57175785 AGAGGAGGCAGCAAATCAACAGG No data
974076935_974076940 9 Left 974076935 4:57175736-57175758 CCTGTCTTTGTTGGTAAATCCAA No data
Right 974076940 4:57175768-57175790 AGGCAGCAAATCAACAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974076935 Original CRISPR TTGGATTTACCAACAAAGAC AGG (reversed) Intergenic
No off target data available for this crispr