ID: 974077909

View in Genome Browser
Species Human (GRCh38)
Location 4:57184481-57184503
Sequence CCCTGCACGGGGAGGGTCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974077898_974077909 -6 Left 974077898 4:57184464-57184486 CCTTCCCACCTTCTGGACCCTGC No data
Right 974077909 4:57184481-57184503 CCCTGCACGGGGAGGGTCTCGGG No data
974077891_974077909 30 Left 974077891 4:57184428-57184450 CCTTCAGACCTTCCTAAGCTCCA No data
Right 974077909 4:57184481-57184503 CCCTGCACGGGGAGGGTCTCGGG No data
974077896_974077909 10 Left 974077896 4:57184448-57184470 CCAGGTGGAATCTTTGCCTTCCC No data
Right 974077909 4:57184481-57184503 CCCTGCACGGGGAGGGTCTCGGG No data
974077894_974077909 22 Left 974077894 4:57184436-57184458 CCTTCCTAAGCTCCAGGTGGAAT No data
Right 974077909 4:57184481-57184503 CCCTGCACGGGGAGGGTCTCGGG No data
974077899_974077909 -10 Left 974077899 4:57184468-57184490 CCCACCTTCTGGACCCTGCACGG No data
Right 974077909 4:57184481-57184503 CCCTGCACGGGGAGGGTCTCGGG No data
974077895_974077909 18 Left 974077895 4:57184440-57184462 CCTAAGCTCCAGGTGGAATCTTT No data
Right 974077909 4:57184481-57184503 CCCTGCACGGGGAGGGTCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974077909 Original CRISPR CCCTGCACGGGGAGGGTCTC GGG Intergenic
No off target data available for this crispr