ID: 974078745

View in Genome Browser
Species Human (GRCh38)
Location 4:57191838-57191860
Sequence TTGTCAAAATGCAACATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974078743_974078745 6 Left 974078743 4:57191809-57191831 CCACAGCCTTTAGTCTCTACATG No data
Right 974078745 4:57191838-57191860 TTGTCAAAATGCAACATCAAAGG No data
974078742_974078745 24 Left 974078742 4:57191791-57191813 CCATAGCAGCAGGTGAGGCCACA No data
Right 974078745 4:57191838-57191860 TTGTCAAAATGCAACATCAAAGG No data
974078744_974078745 0 Left 974078744 4:57191815-57191837 CCTTTAGTCTCTACATGACTTCT No data
Right 974078745 4:57191838-57191860 TTGTCAAAATGCAACATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974078745 Original CRISPR TTGTCAAAATGCAACATCAA AGG Intergenic
No off target data available for this crispr