ID: 974079393

View in Genome Browser
Species Human (GRCh38)
Location 4:57196583-57196605
Sequence TGGCAGGATCGCTTAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974079393_974079396 -1 Left 974079393 4:57196583-57196605 CCTGGGCTTAAGCGATCCTGCCA No data
Right 974079396 4:57196605-57196627 ACTTCAGCTTCCCAAAGTGTTGG 0: 15
1: 514
2: 7824
3: 55459
4: 162293
974079393_974079397 0 Left 974079393 4:57196583-57196605 CCTGGGCTTAAGCGATCCTGCCA No data
Right 974079397 4:57196606-57196628 CTTCAGCTTCCCAAAGTGTTGGG 0: 38
1: 1257
2: 19203
3: 129145
4: 243773
974079393_974079398 8 Left 974079393 4:57196583-57196605 CCTGGGCTTAAGCGATCCTGCCA No data
Right 974079398 4:57196614-57196636 TCCCAAAGTGTTGGGATTACAGG 0: 21407
1: 311432
2: 256151
3: 138115
4: 123943

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974079393 Original CRISPR TGGCAGGATCGCTTAAGCCC AGG (reversed) Intergenic
No off target data available for this crispr