ID: 974084227

View in Genome Browser
Species Human (GRCh38)
Location 4:57242315-57242337
Sequence CATGATAAGGAGTCATTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974084223_974084227 -6 Left 974084223 4:57242298-57242320 CCGTATTTTACTCTAAACATGAT No data
Right 974084227 4:57242315-57242337 CATGATAAGGAGTCATTGGAGGG No data
974084220_974084227 25 Left 974084220 4:57242267-57242289 CCATGGGGCCTTGGGAGTCTTTG No data
Right 974084227 4:57242315-57242337 CATGATAAGGAGTCATTGGAGGG No data
974084219_974084227 26 Left 974084219 4:57242266-57242288 CCCATGGGGCCTTGGGAGTCTTT No data
Right 974084227 4:57242315-57242337 CATGATAAGGAGTCATTGGAGGG No data
974084222_974084227 17 Left 974084222 4:57242275-57242297 CCTTGGGAGTCTTTGTAAGGATA No data
Right 974084227 4:57242315-57242337 CATGATAAGGAGTCATTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974084227 Original CRISPR CATGATAAGGAGTCATTGGA GGG Intergenic
No off target data available for this crispr