ID: 974085687

View in Genome Browser
Species Human (GRCh38)
Location 4:57258431-57258453
Sequence CCTGTTCAATAAACAGTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974085687_974085693 9 Left 974085687 4:57258431-57258453 CCCAACACTGTTTATTGAACAGG No data
Right 974085693 4:57258463-57258485 CCCCATTACTTGTTTTTGTCAGG 0: 68
1: 7534
2: 10489
3: 3229
4: 1102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974085687 Original CRISPR CCTGTTCAATAAACAGTGTT GGG (reversed) Intergenic
No off target data available for this crispr