ID: 974087326

View in Genome Browser
Species Human (GRCh38)
Location 4:57275353-57275375
Sequence GTAACAAATATGTGTAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974087326_974087327 -5 Left 974087326 4:57275353-57275375 CCTGCTTTACACATATTTGTTAC No data
Right 974087327 4:57275371-57275393 GTTACCTTCCTGATTCTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974087326 Original CRISPR GTAACAAATATGTGTAAAGC AGG (reversed) Intergenic
No off target data available for this crispr