ID: 974088902

View in Genome Browser
Species Human (GRCh38)
Location 4:57289885-57289907
Sequence ATCTCTATGGGGGAGTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974088893_974088902 9 Left 974088893 4:57289853-57289875 CCGTTCTAACAGTAGACGTTTAG No data
Right 974088902 4:57289885-57289907 ATCTCTATGGGGGAGTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974088902 Original CRISPR ATCTCTATGGGGGAGTGGGA GGG Intergenic
No off target data available for this crispr