ID: 974110070

View in Genome Browser
Species Human (GRCh38)
Location 4:57514986-57515008
Sequence CTGCAGCAATACAGGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974110070_974110075 16 Left 974110070 4:57514986-57515008 CCCAGCTCCCTGTATTGCTGCAG No data
Right 974110075 4:57515025-57515047 CATCCTTGACTTCACTGATATGG No data
974110070_974110074 -8 Left 974110070 4:57514986-57515008 CCCAGCTCCCTGTATTGCTGCAG No data
Right 974110074 4:57515001-57515023 TGCTGCAGCTCTTATAGCAGAGG No data
974110070_974110077 26 Left 974110070 4:57514986-57515008 CCCAGCTCCCTGTATTGCTGCAG No data
Right 974110077 4:57515035-57515057 TTCACTGATATGGATCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974110070 Original CRISPR CTGCAGCAATACAGGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr