ID: 974112633

View in Genome Browser
Species Human (GRCh38)
Location 4:57543261-57543283
Sequence AATTGTTAACATAATGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974112633_974112636 16 Left 974112633 4:57543261-57543283 CCCACCTCATTATGTTAACAATT No data
Right 974112636 4:57543300-57543322 ACAAAAACATAAAACTTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974112633 Original CRISPR AATTGTTAACATAATGAGGT GGG (reversed) Intergenic
No off target data available for this crispr