ID: 974112636

View in Genome Browser
Species Human (GRCh38)
Location 4:57543300-57543322
Sequence ACAAAAACATAAAACTTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974112632_974112636 17 Left 974112632 4:57543260-57543282 CCCCACCTCATTATGTTAACAAT No data
Right 974112636 4:57543300-57543322 ACAAAAACATAAAACTTACAAGG No data
974112634_974112636 15 Left 974112634 4:57543262-57543284 CCACCTCATTATGTTAACAATTA No data
Right 974112636 4:57543300-57543322 ACAAAAACATAAAACTTACAAGG No data
974112635_974112636 12 Left 974112635 4:57543265-57543287 CCTCATTATGTTAACAATTAAAC No data
Right 974112636 4:57543300-57543322 ACAAAAACATAAAACTTACAAGG No data
974112630_974112636 26 Left 974112630 4:57543251-57543273 CCAAAACACCCCCACCTCATTAT No data
Right 974112636 4:57543300-57543322 ACAAAAACATAAAACTTACAAGG No data
974112633_974112636 16 Left 974112633 4:57543261-57543283 CCCACCTCATTATGTTAACAATT No data
Right 974112636 4:57543300-57543322 ACAAAAACATAAAACTTACAAGG No data
974112631_974112636 18 Left 974112631 4:57543259-57543281 CCCCCACCTCATTATGTTAACAA No data
Right 974112636 4:57543300-57543322 ACAAAAACATAAAACTTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974112636 Original CRISPR ACAAAAACATAAAACTTACA AGG Intergenic
No off target data available for this crispr