ID: 974121966

View in Genome Browser
Species Human (GRCh38)
Location 4:57649663-57649685
Sequence CATTCATGGCAGGAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974121960_974121966 -9 Left 974121960 4:57649649-57649671 CCTTCCTGCTGCTTCATTCATGG No data
Right 974121966 4:57649663-57649685 CATTCATGGCAGGAGGTGGAAGG No data
974121959_974121966 -8 Left 974121959 4:57649648-57649670 CCCTTCCTGCTGCTTCATTCATG No data
Right 974121966 4:57649663-57649685 CATTCATGGCAGGAGGTGGAAGG No data
974121957_974121966 20 Left 974121957 4:57649620-57649642 CCAGGGTAGAGGGGCTGATCTGG No data
Right 974121966 4:57649663-57649685 CATTCATGGCAGGAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974121966 Original CRISPR CATTCATGGCAGGAGGTGGA AGG Intergenic
No off target data available for this crispr