ID: 974124236

View in Genome Browser
Species Human (GRCh38)
Location 4:57676233-57676255
Sequence TACTTCAACAGATGCTACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974124236_974124243 21 Left 974124236 4:57676233-57676255 CCCTGGTAGCATCTGTTGAAGTA No data
Right 974124243 4:57676277-57676299 GCTGGACTTCCAGGTCAGACGGG No data
974124236_974124239 3 Left 974124236 4:57676233-57676255 CCCTGGTAGCATCTGTTGAAGTA No data
Right 974124239 4:57676259-57676281 CTTTGAGAGGTGAAGCCAGCTGG No data
974124236_974124240 12 Left 974124236 4:57676233-57676255 CCCTGGTAGCATCTGTTGAAGTA No data
Right 974124240 4:57676268-57676290 GTGAAGCCAGCTGGACTTCCAGG 0: 345
1: 390
2: 387
3: 332
4: 514
974124236_974124238 -10 Left 974124236 4:57676233-57676255 CCCTGGTAGCATCTGTTGAAGTA No data
Right 974124238 4:57676246-57676268 TGTTGAAGTATAACTTTGAGAGG No data
974124236_974124242 20 Left 974124236 4:57676233-57676255 CCCTGGTAGCATCTGTTGAAGTA No data
Right 974124242 4:57676276-57676298 AGCTGGACTTCCAGGTCAGACGG No data
974124236_974124245 28 Left 974124236 4:57676233-57676255 CCCTGGTAGCATCTGTTGAAGTA No data
Right 974124245 4:57676284-57676306 TTCCAGGTCAGACGGGGACTTGG No data
974124236_974124244 22 Left 974124236 4:57676233-57676255 CCCTGGTAGCATCTGTTGAAGTA No data
Right 974124244 4:57676278-57676300 CTGGACTTCCAGGTCAGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974124236 Original CRISPR TACTTCAACAGATGCTACCA GGG (reversed) Intergenic
No off target data available for this crispr