ID: 974124244

View in Genome Browser
Species Human (GRCh38)
Location 4:57676278-57676300
Sequence CTGGACTTCCAGGTCAGACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974124236_974124244 22 Left 974124236 4:57676233-57676255 CCCTGGTAGCATCTGTTGAAGTA No data
Right 974124244 4:57676278-57676300 CTGGACTTCCAGGTCAGACGGGG No data
974124237_974124244 21 Left 974124237 4:57676234-57676256 CCTGGTAGCATCTGTTGAAGTAT No data
Right 974124244 4:57676278-57676300 CTGGACTTCCAGGTCAGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974124244 Original CRISPR CTGGACTTCCAGGTCAGACG GGG Intergenic
No off target data available for this crispr