ID: 974125822

View in Genome Browser
Species Human (GRCh38)
Location 4:57693958-57693980
Sequence TTCCTGCCTCTTTGTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974125819_974125822 -1 Left 974125819 4:57693936-57693958 CCGCTTTGCTCATCACTTCTCCT No data
Right 974125822 4:57693958-57693980 TTCCTGCCTCTTTGTGAGGAAGG No data
974125818_974125822 0 Left 974125818 4:57693935-57693957 CCCGCTTTGCTCATCACTTCTCC No data
Right 974125822 4:57693958-57693980 TTCCTGCCTCTTTGTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974125822 Original CRISPR TTCCTGCCTCTTTGTGAGGA AGG Intergenic
No off target data available for this crispr