ID: 974138295

View in Genome Browser
Species Human (GRCh38)
Location 4:57848777-57848799
Sequence TGGATTTTTATACTCTAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974138288_974138295 18 Left 974138288 4:57848736-57848758 CCCTCATAGCGAAAACCCAAGTG No data
Right 974138295 4:57848777-57848799 TGGATTTTTATACTCTAGATTGG No data
974138292_974138295 3 Left 974138292 4:57848751-57848773 CCCAAGTGAAATGGGCACAAACG No data
Right 974138295 4:57848777-57848799 TGGATTTTTATACTCTAGATTGG No data
974138293_974138295 2 Left 974138293 4:57848752-57848774 CCAAGTGAAATGGGCACAAACGT No data
Right 974138295 4:57848777-57848799 TGGATTTTTATACTCTAGATTGG No data
974138289_974138295 17 Left 974138289 4:57848737-57848759 CCTCATAGCGAAAACCCAAGTGA No data
Right 974138295 4:57848777-57848799 TGGATTTTTATACTCTAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974138295 Original CRISPR TGGATTTTTATACTCTAGAT TGG Intergenic
No off target data available for this crispr