ID: 974142762

View in Genome Browser
Species Human (GRCh38)
Location 4:57908701-57908723
Sequence AAGTGGGGATGGAGAGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974142757_974142762 -5 Left 974142757 4:57908683-57908705 CCATTCGCTCACTTTGGCAAGTG No data
Right 974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974142762 Original CRISPR AAGTGGGGATGGAGAGAAGC AGG Intergenic
No off target data available for this crispr