ID: 974142873

View in Genome Browser
Species Human (GRCh38)
Location 4:57909967-57909989
Sequence ACCACATCTGTGGCCAGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974142871_974142873 -9 Left 974142871 4:57909953-57909975 CCTGGTCAAAGAAAACCACATCT No data
Right 974142873 4:57909967-57909989 ACCACATCTGTGGCCAGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974142873 Original CRISPR ACCACATCTGTGGCCAGACA CGG Intergenic
No off target data available for this crispr