ID: 974143564

View in Genome Browser
Species Human (GRCh38)
Location 4:57919147-57919169
Sequence GACCCCACCACAGCTTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974143564_974143568 -2 Left 974143564 4:57919147-57919169 CCTCCTCAAGCTGTGGTGGGGTC No data
Right 974143568 4:57919168-57919190 TCCACCCAGTTGGAGCTTCCGGG 0: 384
1: 2454
2: 1445
3: 766
4: 635
974143564_974143567 -3 Left 974143564 4:57919147-57919169 CCTCCTCAAGCTGTGGTGGGGTC No data
Right 974143567 4:57919167-57919189 GTCCACCCAGTTGGAGCTTCCGG No data
974143564_974143573 25 Left 974143564 4:57919147-57919169 CCTCCTCAAGCTGTGGTGGGGTC No data
Right 974143573 4:57919195-57919217 TTTGTTTACCTAAGCAAGCCTGG 0: 1980
1: 1027
2: 323
3: 107
4: 156
974143564_974143574 26 Left 974143564 4:57919147-57919169 CCTCCTCAAGCTGTGGTGGGGTC No data
Right 974143574 4:57919196-57919218 TTGTTTACCTAAGCAAGCCTGGG 0: 1960
1: 1038
2: 682
3: 307
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974143564 Original CRISPR GACCCCACCACAGCTTGAGG AGG (reversed) Intergenic
No off target data available for this crispr