ID: 974143567

View in Genome Browser
Species Human (GRCh38)
Location 4:57919167-57919189
Sequence GTCCACCCAGTTGGAGCTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974143554_974143567 28 Left 974143554 4:57919116-57919138 CCCAGAGGTGGAGCCTACAGAGG 0: 2884
1: 1954
2: 1015
3: 509
4: 2121
Right 974143567 4:57919167-57919189 GTCCACCCAGTTGGAGCTTCCGG No data
974143559_974143567 15 Left 974143559 4:57919129-57919151 CCTACAGAGGCAGGCAGGCCTCC 0: 2745
1: 895
2: 208
3: 128
4: 395
Right 974143567 4:57919167-57919189 GTCCACCCAGTTGGAGCTTCCGG No data
974143556_974143567 27 Left 974143556 4:57919117-57919139 CCAGAGGTGGAGCCTACAGAGGC 0: 2816
1: 1872
2: 969
3: 422
4: 378
Right 974143567 4:57919167-57919189 GTCCACCCAGTTGGAGCTTCCGG No data
974143552_974143567 30 Left 974143552 4:57919114-57919136 CCCCCAGAGGTGGAGCCTACAGA 0: 2811
1: 1862
2: 1041
3: 575
4: 648
Right 974143567 4:57919167-57919189 GTCCACCCAGTTGGAGCTTCCGG No data
974143565_974143567 -6 Left 974143565 4:57919150-57919172 CCTCAAGCTGTGGTGGGGTCCAC No data
Right 974143567 4:57919167-57919189 GTCCACCCAGTTGGAGCTTCCGG No data
974143553_974143567 29 Left 974143553 4:57919115-57919137 CCCCAGAGGTGGAGCCTACAGAG 0: 2858
1: 1958
2: 1154
3: 808
4: 3609
Right 974143567 4:57919167-57919189 GTCCACCCAGTTGGAGCTTCCGG No data
974143564_974143567 -3 Left 974143564 4:57919147-57919169 CCTCCTCAAGCTGTGGTGGGGTC No data
Right 974143567 4:57919167-57919189 GTCCACCCAGTTGGAGCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974143567 Original CRISPR GTCCACCCAGTTGGAGCTTC CGG Intergenic
No off target data available for this crispr