ID: 974143568

View in Genome Browser
Species Human (GRCh38)
Location 4:57919168-57919190
Sequence TCCACCCAGTTGGAGCTTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5684
Summary {0: 384, 1: 2454, 2: 1445, 3: 766, 4: 635}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974143554_974143568 29 Left 974143554 4:57919116-57919138 CCCAGAGGTGGAGCCTACAGAGG 0: 2884
1: 1954
2: 1015
3: 509
4: 2121
Right 974143568 4:57919168-57919190 TCCACCCAGTTGGAGCTTCCGGG 0: 384
1: 2454
2: 1445
3: 766
4: 635
974143553_974143568 30 Left 974143553 4:57919115-57919137 CCCCAGAGGTGGAGCCTACAGAG 0: 2858
1: 1958
2: 1154
3: 808
4: 3609
Right 974143568 4:57919168-57919190 TCCACCCAGTTGGAGCTTCCGGG 0: 384
1: 2454
2: 1445
3: 766
4: 635
974143559_974143568 16 Left 974143559 4:57919129-57919151 CCTACAGAGGCAGGCAGGCCTCC 0: 2745
1: 895
2: 208
3: 128
4: 395
Right 974143568 4:57919168-57919190 TCCACCCAGTTGGAGCTTCCGGG 0: 384
1: 2454
2: 1445
3: 766
4: 635
974143556_974143568 28 Left 974143556 4:57919117-57919139 CCAGAGGTGGAGCCTACAGAGGC 0: 2816
1: 1872
2: 969
3: 422
4: 378
Right 974143568 4:57919168-57919190 TCCACCCAGTTGGAGCTTCCGGG 0: 384
1: 2454
2: 1445
3: 766
4: 635
974143565_974143568 -5 Left 974143565 4:57919150-57919172 CCTCAAGCTGTGGTGGGGTCCAC No data
Right 974143568 4:57919168-57919190 TCCACCCAGTTGGAGCTTCCGGG 0: 384
1: 2454
2: 1445
3: 766
4: 635
974143564_974143568 -2 Left 974143564 4:57919147-57919169 CCTCCTCAAGCTGTGGTGGGGTC No data
Right 974143568 4:57919168-57919190 TCCACCCAGTTGGAGCTTCCGGG 0: 384
1: 2454
2: 1445
3: 766
4: 635

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974143568 Original CRISPR TCCACCCAGTTGGAGCTTCC GGG Intergenic
Too many off-targets to display for this crispr