ID: 974143573

View in Genome Browser
Species Human (GRCh38)
Location 4:57919195-57919217
Sequence TTTGTTTACCTAAGCAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3593
Summary {0: 1980, 1: 1027, 2: 323, 3: 107, 4: 156}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974143565_974143573 22 Left 974143565 4:57919150-57919172 CCTCAAGCTGTGGTGGGGTCCAC No data
Right 974143573 4:57919195-57919217 TTTGTTTACCTAAGCAAGCCTGG 0: 1980
1: 1027
2: 323
3: 107
4: 156
974143570_974143573 0 Left 974143570 4:57919172-57919194 CCCAGTTGGAGCTTCCGGGCTGC 0: 19
1: 438
2: 2068
3: 1659
4: 1448
Right 974143573 4:57919195-57919217 TTTGTTTACCTAAGCAAGCCTGG 0: 1980
1: 1027
2: 323
3: 107
4: 156
974143569_974143573 3 Left 974143569 4:57919169-57919191 CCACCCAGTTGGAGCTTCCGGGC 0: 20
1: 466
2: 2568
3: 2121
4: 1510
Right 974143573 4:57919195-57919217 TTTGTTTACCTAAGCAAGCCTGG 0: 1980
1: 1027
2: 323
3: 107
4: 156
974143564_974143573 25 Left 974143564 4:57919147-57919169 CCTCCTCAAGCTGTGGTGGGGTC No data
Right 974143573 4:57919195-57919217 TTTGTTTACCTAAGCAAGCCTGG 0: 1980
1: 1027
2: 323
3: 107
4: 156
974143571_974143573 -1 Left 974143571 4:57919173-57919195 CCAGTTGGAGCTTCCGGGCTGCT 0: 21
1: 442
2: 2075
3: 1645
4: 1449
Right 974143573 4:57919195-57919217 TTTGTTTACCTAAGCAAGCCTGG 0: 1980
1: 1027
2: 323
3: 107
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974143573 Original CRISPR TTTGTTTACCTAAGCAAGCC TGG Intergenic
Too many off-targets to display for this crispr