ID: 974143574

View in Genome Browser
Species Human (GRCh38)
Location 4:57919196-57919218
Sequence TTGTTTACCTAAGCAAGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4166
Summary {0: 1960, 1: 1038, 2: 682, 3: 307, 4: 179}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974143569_974143574 4 Left 974143569 4:57919169-57919191 CCACCCAGTTGGAGCTTCCGGGC 0: 20
1: 466
2: 2568
3: 2121
4: 1510
Right 974143574 4:57919196-57919218 TTGTTTACCTAAGCAAGCCTGGG 0: 1960
1: 1038
2: 682
3: 307
4: 179
974143571_974143574 0 Left 974143571 4:57919173-57919195 CCAGTTGGAGCTTCCGGGCTGCT 0: 21
1: 442
2: 2075
3: 1645
4: 1449
Right 974143574 4:57919196-57919218 TTGTTTACCTAAGCAAGCCTGGG 0: 1960
1: 1038
2: 682
3: 307
4: 179
974143565_974143574 23 Left 974143565 4:57919150-57919172 CCTCAAGCTGTGGTGGGGTCCAC No data
Right 974143574 4:57919196-57919218 TTGTTTACCTAAGCAAGCCTGGG 0: 1960
1: 1038
2: 682
3: 307
4: 179
974143564_974143574 26 Left 974143564 4:57919147-57919169 CCTCCTCAAGCTGTGGTGGGGTC No data
Right 974143574 4:57919196-57919218 TTGTTTACCTAAGCAAGCCTGGG 0: 1960
1: 1038
2: 682
3: 307
4: 179
974143570_974143574 1 Left 974143570 4:57919172-57919194 CCCAGTTGGAGCTTCCGGGCTGC 0: 19
1: 438
2: 2068
3: 1659
4: 1448
Right 974143574 4:57919196-57919218 TTGTTTACCTAAGCAAGCCTGGG 0: 1960
1: 1038
2: 682
3: 307
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974143574 Original CRISPR TTGTTTACCTAAGCAAGCCT GGG Intergenic
Too many off-targets to display for this crispr