ID: 974148361

View in Genome Browser
Species Human (GRCh38)
Location 4:57973843-57973865
Sequence GTGGAAGACCAAGTAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974148361_974148366 10 Left 974148361 4:57973843-57973865 CCAGTTTTTACTTGGTCTTCCAC No data
Right 974148366 4:57973876-57973898 GGCAATGTATTGACGTGGAGAGG No data
974148361_974148365 5 Left 974148361 4:57973843-57973865 CCAGTTTTTACTTGGTCTTCCAC No data
Right 974148365 4:57973871-57973893 GGAAAGGCAATGTATTGACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974148361 Original CRISPR GTGGAAGACCAAGTAAAAAC TGG (reversed) Intergenic
No off target data available for this crispr