ID: 974152954

View in Genome Browser
Species Human (GRCh38)
Location 4:58033081-58033103
Sequence CATAAGTCCAGCCCACAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974152954_974152959 20 Left 974152954 4:58033081-58033103 CCTGTTTGTGGGCTGGACTTATG No data
Right 974152959 4:58033124-58033146 CAACAAAGGAGGAAGCACTCAGG No data
974152954_974152956 6 Left 974152954 4:58033081-58033103 CCTGTTTGTGGGCTGGACTTATG No data
Right 974152956 4:58033110-58033132 GAATTCGCTACCAGCAACAAAGG No data
974152954_974152957 9 Left 974152954 4:58033081-58033103 CCTGTTTGTGGGCTGGACTTATG No data
Right 974152957 4:58033113-58033135 TTCGCTACCAGCAACAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974152954 Original CRISPR CATAAGTCCAGCCCACAAAC AGG (reversed) Intergenic
No off target data available for this crispr