ID: 974152959

View in Genome Browser
Species Human (GRCh38)
Location 4:58033124-58033146
Sequence CAACAAAGGAGGAAGCACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974152953_974152959 25 Left 974152953 4:58033076-58033098 CCACTCCTGTTTGTGGGCTGGAC No data
Right 974152959 4:58033124-58033146 CAACAAAGGAGGAAGCACTCAGG No data
974152954_974152959 20 Left 974152954 4:58033081-58033103 CCTGTTTGTGGGCTGGACTTATG No data
Right 974152959 4:58033124-58033146 CAACAAAGGAGGAAGCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974152959 Original CRISPR CAACAAAGGAGGAAGCACTC AGG Intergenic
No off target data available for this crispr