ID: 974167958

View in Genome Browser
Species Human (GRCh38)
Location 4:58228444-58228466
Sequence TCTCATCAAAACCATTATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974167955_974167958 2 Left 974167955 4:58228419-58228441 CCAGAAGGGGCATACAGGACAGT No data
Right 974167958 4:58228444-58228466 TCTCATCAAAACCATTATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974167958 Original CRISPR TCTCATCAAAACCATTATAG GGG Intergenic
No off target data available for this crispr