ID: 974169650

View in Genome Browser
Species Human (GRCh38)
Location 4:58250210-58250232
Sequence CTGGACTCCTTGAGAGACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974169650_974169661 28 Left 974169650 4:58250210-58250232 CCCCTGTCTCTCAAGGAGTCCAG No data
Right 974169661 4:58250261-58250283 CCACTGGTACAAAATGTAAAGGG No data
974169650_974169656 -10 Left 974169650 4:58250210-58250232 CCCCTGTCTCTCAAGGAGTCCAG No data
Right 974169656 4:58250223-58250245 AGGAGTCCAGGACTAGGGCAAGG No data
974169650_974169659 27 Left 974169650 4:58250210-58250232 CCCCTGTCTCTCAAGGAGTCCAG No data
Right 974169659 4:58250260-58250282 TCCACTGGTACAAAATGTAAAGG No data
974169650_974169658 12 Left 974169650 4:58250210-58250232 CCCCTGTCTCTCAAGGAGTCCAG No data
Right 974169658 4:58250245-58250267 GAGAATGAAGTACTCTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974169650 Original CRISPR CTGGACTCCTTGAGAGACAG GGG (reversed) Intergenic
No off target data available for this crispr