ID: 974169656

View in Genome Browser
Species Human (GRCh38)
Location 4:58250223-58250245
Sequence AGGAGTCCAGGACTAGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974169650_974169656 -10 Left 974169650 4:58250210-58250232 CCCCTGTCTCTCAAGGAGTCCAG No data
Right 974169656 4:58250223-58250245 AGGAGTCCAGGACTAGGGCAAGG No data
974169648_974169656 17 Left 974169648 4:58250183-58250205 CCAGGAGATTTGATGAGTCTTGA No data
Right 974169656 4:58250223-58250245 AGGAGTCCAGGACTAGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974169656 Original CRISPR AGGAGTCCAGGACTAGGGCA AGG Intergenic
No off target data available for this crispr