ID: 974169661

View in Genome Browser
Species Human (GRCh38)
Location 4:58250261-58250283
Sequence CCACTGGTACAAAATGTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974169650_974169661 28 Left 974169650 4:58250210-58250232 CCCCTGTCTCTCAAGGAGTCCAG No data
Right 974169661 4:58250261-58250283 CCACTGGTACAAAATGTAAAGGG No data
974169657_974169661 9 Left 974169657 4:58250229-58250251 CCAGGACTAGGGCAAGGAGAATG No data
Right 974169661 4:58250261-58250283 CCACTGGTACAAAATGTAAAGGG No data
974169651_974169661 27 Left 974169651 4:58250211-58250233 CCCTGTCTCTCAAGGAGTCCAGG No data
Right 974169661 4:58250261-58250283 CCACTGGTACAAAATGTAAAGGG No data
974169653_974169661 26 Left 974169653 4:58250212-58250234 CCTGTCTCTCAAGGAGTCCAGGA No data
Right 974169661 4:58250261-58250283 CCACTGGTACAAAATGTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974169661 Original CRISPR CCACTGGTACAAAATGTAAA GGG Intergenic
No off target data available for this crispr