ID: 974170806

View in Genome Browser
Species Human (GRCh38)
Location 4:58264793-58264815
Sequence GCTCAAGTATGTGCACTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974170801_974170806 8 Left 974170801 4:58264762-58264784 CCCAATATGATCTTAGGAGCTGG No data
Right 974170806 4:58264793-58264815 GCTCAAGTATGTGCACTAAGAGG No data
974170803_974170806 7 Left 974170803 4:58264763-58264785 CCAATATGATCTTAGGAGCTGGG No data
Right 974170806 4:58264793-58264815 GCTCAAGTATGTGCACTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974170806 Original CRISPR GCTCAAGTATGTGCACTAAG AGG Intergenic
No off target data available for this crispr