ID: 974178828

View in Genome Browser
Species Human (GRCh38)
Location 4:58359452-58359474
Sequence ATGTATTAGCAGAATGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974178827_974178828 -3 Left 974178827 4:58359432-58359454 CCAATCTTGGGTATGTCTTTATG No data
Right 974178828 4:58359452-58359474 ATGTATTAGCAGAATGAGAAAGG No data
974178821_974178828 25 Left 974178821 4:58359404-58359426 CCCAATAATTTACCCAATTATAA No data
Right 974178828 4:58359452-58359474 ATGTATTAGCAGAATGAGAAAGG No data
974178823_974178828 13 Left 974178823 4:58359416-58359438 CCCAATTATAAATTATCCAATCT No data
Right 974178828 4:58359452-58359474 ATGTATTAGCAGAATGAGAAAGG No data
974178822_974178828 24 Left 974178822 4:58359405-58359427 CCAATAATTTACCCAATTATAAA No data
Right 974178828 4:58359452-58359474 ATGTATTAGCAGAATGAGAAAGG No data
974178824_974178828 12 Left 974178824 4:58359417-58359439 CCAATTATAAATTATCCAATCTT No data
Right 974178828 4:58359452-58359474 ATGTATTAGCAGAATGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974178828 Original CRISPR ATGTATTAGCAGAATGAGAA AGG Intergenic
No off target data available for this crispr