ID: 974186718

View in Genome Browser
Species Human (GRCh38)
Location 4:58456718-58456740
Sequence TTACATGTGAATAAGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974186718_974186721 -2 Left 974186718 4:58456718-58456740 CCCTCCTGCTTATTCACATGTAA No data
Right 974186721 4:58456739-58456761 AAAATAGAATAGAAGCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974186718 Original CRISPR TTACATGTGAATAAGCAGGA GGG (reversed) Intergenic
No off target data available for this crispr