ID: 974189543

View in Genome Browser
Species Human (GRCh38)
Location 4:58486796-58486818
Sequence CAAACTACTGCCCTCAAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974189543_974189544 -2 Left 974189543 4:58486796-58486818 CCAATTTTGAGGGCAGTAGTTTG No data
Right 974189544 4:58486817-58486839 TGCCCTATGATTTTATTTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974189543 Original CRISPR CAAACTACTGCCCTCAAAAT TGG (reversed) Intergenic
No off target data available for this crispr