ID: 974189544

View in Genome Browser
Species Human (GRCh38)
Location 4:58486817-58486839
Sequence TGCCCTATGATTTTATTTTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974189539_974189544 14 Left 974189539 4:58486780-58486802 CCACCTGTGGGTCTCTCCAATTT No data
Right 974189544 4:58486817-58486839 TGCCCTATGATTTTATTTTTCGG No data
974189543_974189544 -2 Left 974189543 4:58486796-58486818 CCAATTTTGAGGGCAGTAGTTTG No data
Right 974189544 4:58486817-58486839 TGCCCTATGATTTTATTTTTCGG No data
974189540_974189544 11 Left 974189540 4:58486783-58486805 CCTGTGGGTCTCTCCAATTTTGA No data
Right 974189544 4:58486817-58486839 TGCCCTATGATTTTATTTTTCGG No data
974189538_974189544 15 Left 974189538 4:58486779-58486801 CCCACCTGTGGGTCTCTCCAATT No data
Right 974189544 4:58486817-58486839 TGCCCTATGATTTTATTTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974189544 Original CRISPR TGCCCTATGATTTTATTTTT CGG Intergenic
No off target data available for this crispr