ID: 974190477

View in Genome Browser
Species Human (GRCh38)
Location 4:58496509-58496531
Sequence TCCACCCCTCTGGATCTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 684
Summary {0: 10, 1: 48, 2: 85, 3: 148, 4: 393}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974190477_974190482 -10 Left 974190477 4:58496509-58496531 CCCGCCAGATCCAGAGGGGTGGA 0: 10
1: 48
2: 85
3: 148
4: 393
Right 974190482 4:58496522-58496544 GAGGGGTGGAAGTCAACAGCGGG No data
974190477_974190486 23 Left 974190477 4:58496509-58496531 CCCGCCAGATCCAGAGGGGTGGA 0: 10
1: 48
2: 85
3: 148
4: 393
Right 974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG No data
974190477_974190483 3 Left 974190477 4:58496509-58496531 CCCGCCAGATCCAGAGGGGTGGA 0: 10
1: 48
2: 85
3: 148
4: 393
Right 974190483 4:58496535-58496557 CAACAGCGGGTCTGCAACAATGG No data
974190477_974190485 19 Left 974190477 4:58496509-58496531 CCCGCCAGATCCAGAGGGGTGGA 0: 10
1: 48
2: 85
3: 148
4: 393
Right 974190485 4:58496551-58496573 ACAATGGCGATCAGCAGTGGTGG No data
974190477_974190484 16 Left 974190477 4:58496509-58496531 CCCGCCAGATCCAGAGGGGTGGA 0: 10
1: 48
2: 85
3: 148
4: 393
Right 974190484 4:58496548-58496570 GCAACAATGGCGATCAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974190477 Original CRISPR TCCACCCCTCTGGATCTGGC GGG (reversed) Intergenic
900133633 1:1103619-1103641 TCCTCCCCTCTGGCTCTTTCTGG + Intronic
900979969 1:6040721-6040743 TCCTCCCCTCTGGAGGTGGAAGG + Intronic
901602574 1:10433302-10433324 CCCACCCCTCTCGATTTGGAGGG - Intronic
902227950 1:15008577-15008599 TAAACCCCTCTGGAACAGGCAGG + Intronic
902538646 1:17136683-17136705 CCCAACCCTCAGGATCTGGTAGG + Intergenic
903275203 1:22217135-22217157 TCCACCCCTCTGAGTGTGGGTGG - Intergenic
903305387 1:22409265-22409287 TCTACCCCTCAGGACTTGGCAGG + Intergenic
904397182 1:30229837-30229859 TCCACCCCTCCGGATCCGGCAGG + Intergenic
906507521 1:46391139-46391161 TCCATCCCTCTGGATCCGGCAGG - Intergenic
907506067 1:54919099-54919121 TCTATCCCTCTGAATCCGGCAGG - Intergenic
907602959 1:55788500-55788522 TCCACCCCTCTGGATACGGCAGG - Intergenic
908234804 1:62138692-62138714 TCCAGGCCTCTGGGTCTAGCGGG + Intronic
908717668 1:67087563-67087585 TCCACCCCTCCAGATCTGGCAGG + Intergenic
908723219 1:67148182-67148204 TCCACCCCTCTGGATCCGGCAGG - Intronic
908852959 1:68392349-68392371 TTCACCCCTCTAGATCCGGCAGG - Intergenic
908892688 1:68863891-68863913 TCCACCCCTCTGGATCCGGCTGG + Intergenic
908932235 1:69331263-69331285 TCCACTCCTGTGGCTCTGGAGGG + Intergenic
909271536 1:73628756-73628778 TCCACTCCTGTGGCTCTGCCGGG + Intergenic
909604881 1:77498088-77498110 TCTTCTCCTCTGGCTCTGGCAGG - Intronic
909756997 1:79239527-79239549 TCCACCCCTGTGGCTCTGCAGGG + Intergenic
910013737 1:82496177-82496199 TCCACCCCTGTGGCTCTGAAAGG + Intergenic
910116674 1:83739164-83739186 TCCATCCCTCTGGATCCGGCAGG - Intergenic
911009307 1:93262604-93262626 TCCACCCCTGTGGTTCTGCAGGG + Intronic
911158119 1:94656296-94656318 TCCACCCCTCTGAATGGGGCAGG - Intergenic
912285713 1:108366246-108366268 TCCATCCCTCCGGATCCAGCAGG - Intergenic
912463397 1:109852550-109852572 TCCGCCCCTCTGGATCCGGCAGG - Intergenic
912712297 1:111958683-111958705 TCTACCGCTCTGGAGCTGGCAGG + Intronic
913440265 1:118889522-118889544 TCCTCCCCTCTGTACCTGCCAGG + Intronic
913470776 1:119183084-119183106 TCCAACCCTCTGGATCTGGCAGG - Intergenic
915565632 1:156711150-156711172 CCCTCCCCTCTTGAACTGGCAGG + Intergenic
915722410 1:157994373-157994395 TCCCCCCCTCTGTATCAAGCGGG - Intronic
917097525 1:171414029-171414051 TCCACCCCTTGGGATCTGGCAGG - Intergenic
917205227 1:172564374-172564396 TCCACCCCTGTGGTTCTGCAGGG - Intronic
917403526 1:174678885-174678907 TCCATCCCTCCGGATAGGGCAGG - Intronic
917413371 1:174783114-174783136 TCCAGCCCTCTGGATCCTGCAGG + Intronic
917438527 1:175045264-175045286 TCCACCCCGTCGGAGCTGGCAGG - Intergenic
917539659 1:175900387-175900409 TCAAGCCCACTGGACCTGGCCGG - Intergenic
918525657 1:185461622-185461644 TCCACATCTGTGGATCTGGAGGG - Intergenic
919039272 1:192361740-192361762 TCCACCATGTTGGATCTGGCTGG + Intronic
920639845 1:207741472-207741494 TCCATTCCTCCGGATCCGGCAGG - Intergenic
922007931 1:221551009-221551031 TCCATCCCTCCAGATCAGGCAGG - Intergenic
922236607 1:223726954-223726976 GCCATCCCTCTGAAACTGGCAGG - Intronic
922683925 1:227624831-227624853 TCCATCCCTCTGGATCTGGCAGG - Intronic
922685152 1:227633116-227633138 TCCACCCCTCCGGATCCGGCAGG - Intronic
922877776 1:228953936-228953958 TCCATCCCTCTGGATCTGGCAGG + Intergenic
922886573 1:229025101-229025123 TCCACCCTCCTGGCACTGGCTGG + Intergenic
924002308 1:239567893-239567915 TCCACCTCTCTGGTTCCTGCTGG + Intronic
924036514 1:239943733-239943755 TCCACCCCTGTGGCTTTGCCAGG + Intergenic
924152376 1:241142137-241142159 TCCACCCCTGTGGCTCTGCAGGG + Intronic
1062834075 10:624586-624608 GCAGCCCCTCTGGATGTGGCTGG + Intronic
1065199853 10:23301966-23301988 TCCATCCCTCTGGATCCAGCAGG - Intronic
1065222791 10:23513331-23513353 TTCACCACTCCGGATCCGGCAGG - Intergenic
1066246831 10:33591918-33591940 TCCATCCCTCTGGATCCAGCAGG - Intergenic
1066673009 10:37859411-37859433 TCCATCCCTCCGGATCTGGCAGG - Intergenic
1067039185 10:42939989-42940011 TCCACCCCTGTGCATCTGTGAGG + Intergenic
1068184260 10:53564548-53564570 TCCACCCCTGTGGATTTGCAGGG - Intergenic
1068191620 10:53659798-53659820 TCCATCCCTCCGGATCCGGCAGG + Intergenic
1068791289 10:61034006-61034028 TCCACCCCTCCGGATCTGGCAGG - Intergenic
1068792064 10:61039471-61039493 TCCACCCCTCCGGATATGGCAGG - Intergenic
1068946884 10:62738609-62738631 TCCACCCATCTGCATCTTGCTGG - Intergenic
1068988842 10:63130969-63130991 TCCACCCCTCTGGATCCATCAGG - Intergenic
1069037959 10:63664954-63664976 TCCACCCCTCTGGATCCCGCAGG - Intergenic
1071034909 10:81233312-81233334 TCCACCCCTATGGCTCTGCAGGG - Intergenic
1071051880 10:81460207-81460229 TCCATCCCTCTGGATCCAGCAGG + Intergenic
1071082697 10:81831266-81831288 TCCGCCCCTCTGGATCTGGCAGG - Intergenic
1071326719 10:84525688-84525710 TCCACCCCTCCGGATCTGGCAGG - Intergenic
1071327408 10:84530628-84530650 TCCACCCCTCTGGATCTGGCAGG - Intergenic
1071557001 10:86612127-86612149 TCCATCCCTCCGGTTCCGGCAGG + Intergenic
1071962816 10:90823256-90823278 TCCACCCCTGTGTATCTGCAGGG - Intronic
1072378556 10:94841346-94841368 TCCATCCCTCCAGATCTGGCAGG - Intronic
1072472431 10:95724683-95724705 TCCACCCCTCTGGATCCAGCAGG - Intronic
1072650319 10:97290283-97290305 CCCATCCCTCCGGATCTGGCAGG + Intronic
1074978459 10:118599843-118599865 TCCACCCCTCTGGATGCAGCAGG - Intergenic
1075315485 10:121449891-121449913 TCAACCCCTTTGGGACTGGCAGG - Intergenic
1078191867 11:9097734-9097756 TCCACCCCTCCAGATCCGGCAGG + Intronic
1079143902 11:17833641-17833663 TCCACCCCTGTGGATTTGCAGGG - Intronic
1079601737 11:22317895-22317917 TCCATCCCTCCGGATGCGGCAGG - Intergenic
1079761857 11:24338973-24338995 TCCACACCTCTGGATTCTGCAGG + Intergenic
1079884279 11:25966515-25966537 TCCATCCCTCAGGATCCAGCAGG - Intergenic
1079933250 11:26590769-26590791 TCCACCCCTCCGGATCCAGCAGG - Intronic
1079934235 11:26597488-26597510 TCAACCCCTCCAGATCCGGCAGG - Intronic
1080946265 11:36978711-36978733 TCCACCCCTGTGGTTCTGCAGGG + Intergenic
1081063039 11:38504042-38504064 TCCACCCCTCTGGATCCAGCAGG + Intergenic
1081069733 11:38595819-38595841 TCCATCCCTCTGGATCCAGCAGG - Intergenic
1081070183 11:38602018-38602040 TCCACCCCTTTGGATCCAGCAGG + Intergenic
1081070866 11:38606891-38606913 TCCACCACTTTGGATCCAGCAGG + Intergenic
1081316489 11:41637258-41637280 TCCACCCCTGTGGCTTTGCCAGG + Intergenic
1081568913 11:44277626-44277648 TTCAGCCCTCAGGATCTGGATGG - Intronic
1081645159 11:44785217-44785239 TCCATGTCTCTGGATCTGGTTGG - Intronic
1081651970 11:44830184-44830206 TCCAGCCCTCTCCACCTGGCTGG + Intronic
1081857851 11:46315240-46315262 CCCACCCCTCTGTCTCTGGCTGG + Intronic
1081866137 11:46361743-46361765 TTCCTCCCTCTGTATCTGGCTGG + Intronic
1082737611 11:56873946-56873968 TCCACCCCTCCAGATCCGGCAGG + Intergenic
1083107008 11:60368086-60368108 TCTACCCCTCCGGATCTGGCAGG + Intronic
1083136041 11:60677897-60677919 TCCACCCCTGTGGCTCTGCAGGG + Intergenic
1084878731 11:72154346-72154368 TCCACCCCTCCAGATCTGGCAGG + Intergenic
1085601985 11:77863296-77863318 TCCATCCCTCCGGATCCGGCAGG - Intronic
1085621576 11:78041731-78041753 CCCATCCCTCCGGATCTGGCAGG + Intronic
1085818907 11:79771060-79771082 TCCACCCCTGTGGCTCTGCCAGG - Intergenic
1085900971 11:80699524-80699546 TCCACCCCTCCGGATCCGGCAGG - Intergenic
1086511203 11:87559875-87559897 TCCACCCCTCCAGATCCGGCAGG - Intergenic
1087901295 11:103644846-103644868 TCCACCCCTCCAGATCCGGCAGG - Intergenic
1088110102 11:106251181-106251203 TCTATCCCTCTGGATCTGGCAGG + Intergenic
1088484617 11:110328700-110328722 TCCACCACTCTGGATCAGGCAGG - Intergenic
1088879807 11:113964532-113964554 TCCATCCTTCTGGATCCAGCAGG + Intergenic
1091039468 11:132263119-132263141 GCCACCCCACTGGGTCTGGAAGG - Intronic
1091123953 11:133080158-133080180 TCCGGCCATCTGCATCTGGCTGG - Intronic
1092293648 12:7181312-7181334 TCCACCCCTCCGGATCTGGCAGG + Intergenic
1092469918 12:8768281-8768303 TCCACCCCTCCAGATCCAGCAGG - Intronic
1093106656 12:15095415-15095437 TCCATCCCTCTGGATCCGGCAGG - Intergenic
1094295319 12:28898785-28898807 TCCACCCCTCTGGCTTTGCAGGG - Intergenic
1095138582 12:38636666-38636688 CCCACCCCTCCGGATCTGGCAGG + Intergenic
1095213925 12:39526648-39526670 TCCACCCCTGTGGCTTTGGAGGG + Intergenic
1095283470 12:40384053-40384075 CCTACCCCTCCGGATCTGGCAGG + Intergenic
1095284202 12:40389213-40389235 TCCACCCCTCCAGATTTGGCAGG + Intergenic
1095893106 12:47253016-47253038 TCCATCCCTCCAGATCAGGCAGG - Intergenic
1096351228 12:50902815-50902837 TCCATTCCTCTGGGTCCGGCAGG - Intergenic
1096352545 12:50912186-50912208 TCCATCCCTCTGGATCTGGCAGG - Intergenic
1096939398 12:55325702-55325724 TCCATCCCTCCAGATCTGGCAGG + Intergenic
1097401580 12:59134500-59134522 TCCACCCCTGTGGCTCTGCAGGG + Intergenic
1097840852 12:64320004-64320026 TCCATCCCTCCGGATCCGGCAGG + Intronic
1098984879 12:77001494-77001516 TCCACCCCTCCGGATCTGGCAGG + Intergenic
1099292621 12:80790119-80790141 TCCATCCCTCTGGATCCAGCAGG + Intergenic
1099568090 12:84278487-84278509 TCCAACCCTGTGGCTCTGCCAGG + Intergenic
1099587201 12:84533457-84533479 TCCACCCCTGTGGCTCTGCAGGG - Intergenic
1099605039 12:84794137-84794159 TCCACCCCTCCGGATCCGGCAGG + Intergenic
1100205060 12:92339661-92339683 TCCATGCCTCTGGATCTGGCAGG - Intergenic
1100937857 12:99690682-99690704 TCCACCCCTGTGGCTCTGCAGGG + Intronic
1101555290 12:105803002-105803024 TCCACCCCTCTAGATCCGACAGG - Intergenic
1102602119 12:114039366-114039388 TCCAACCACCAGGATCTGGCTGG - Intergenic
1103802561 12:123548839-123548861 TCCACCCCTCCGGATCTGGCAGG + Intergenic
1103872335 12:124100796-124100818 TCCACCCCTCCGGATCCGGCAGG - Intronic
1103873173 12:124105971-124105993 TCCACCCCTCCGGATCCAGCAGG - Intronic
1104850961 12:131873518-131873540 TCCACCCCTCTGGATCCGGCAGG - Intergenic
1107156422 13:37172361-37172383 TCCATCCCTCCGGATCCGGCAGG - Intergenic
1107700916 13:43046823-43046845 TACACCCCTCTGGATCCAGCAGG + Intronic
1108877228 13:55061382-55061404 CCCATCCCTCCAGATCTGGCAGG + Intergenic
1109292826 13:60497121-60497143 TCCACCCTTCCGGATCCAGCAGG - Intronic
1109520624 13:63505540-63505562 TCCATCCCTCTGGATCCGGCGGG - Intergenic
1109931303 13:69222057-69222079 CCCATCCCTCCGGATCCGGCAGG + Intergenic
1110846149 13:80192474-80192496 TCCATCCCTCCGGATCTGGCAGG + Intergenic
1110987071 13:81984398-81984420 TCCATCCCTCCAGATCCGGCAGG - Intergenic
1111021449 13:82457727-82457749 CCCATCCCTCCGGATCCGGCAGG + Intergenic
1111072615 13:83188127-83188149 TCCACCCCTGTGGCTCTGCAGGG - Intergenic
1111085523 13:83371733-83371755 TCCACCCCTGTGGTTCTGCAGGG + Intergenic
1111100905 13:83584904-83584926 TCCATCCCTCAGGATCCAGCAGG - Intergenic
1111536791 13:89612075-89612097 TCCATCCCTCTGGATCCGGCAGG - Intergenic
1111709774 13:91796317-91796339 TCCAACCCTCCAGATCCGGCAGG - Intronic
1111753004 13:92358308-92358330 TCCACCCCTGTGGCTCTGCAGGG + Intronic
1111820403 13:93206938-93206960 TCCATCCCTCCGGATCCGGCAGG + Intergenic
1111910267 13:94303030-94303052 CCCACCCCTCCGGATCCCGCGGG - Intronic
1114383854 14:22236778-22236800 TCCATCCCTCCAGATCTGGCAGG + Intergenic
1114384830 14:22243825-22243847 TCCATCCCTCCAGATCCGGCAGG + Intergenic
1114840846 14:26260627-26260649 TCCATCCCTCCAGATCCGGCAGG + Intergenic
1115151666 14:30293309-30293331 TCCACCCCTCCAGATCCAGCAGG + Intergenic
1115757570 14:36544475-36544497 TCTATCCCTCCGGATCCGGCAGG - Intergenic
1116242691 14:42366513-42366535 TTCAGCCCTTGGGATCTGGCAGG + Intergenic
1116694124 14:48150359-48150381 TCCACCCCTGTGGCTCTGCAGGG - Intergenic
1117171816 14:53108170-53108192 TCCATCCCTCCGGATCCGGCAGG + Intronic
1117503378 14:56376118-56376140 CCCGCCCCTCTTGATCAGGCAGG + Intergenic
1118453510 14:65925211-65925233 CCCAACCCTCCGGATCCGGCAGG - Intergenic
1118766465 14:68912836-68912858 TCCTCCCCTCTTCATCAGGCTGG - Intronic
1119089936 14:71772171-71772193 TCCATCCCTCCAGATCTGGCAGG - Intergenic
1119446952 14:74673015-74673037 TCCACCCTCATGGATGTGGCTGG + Intronic
1120097383 14:80403905-80403927 TCCATCCCTCTGGATCCAGCAGG + Intergenic
1120107979 14:80517932-80517954 TCCACCCCTCTGGATCTGGCAGG - Intronic
1120225910 14:81790676-81790698 TCCACCCCTGTGGCTTTGCCAGG - Intergenic
1120341441 14:83225740-83225762 TCCATCCCTCTGAATCCGCCAGG + Intergenic
1120397390 14:83985626-83985648 TCCATCCCTCTGGATCCGGCAGG + Intergenic
1120854063 14:89197576-89197598 TCCAGCACTCTGGATGTTGCAGG - Intronic
1121318840 14:92979027-92979049 TCCACCCCTGTGGCTCTGCAGGG - Intronic
1121774326 14:96580426-96580448 ACCACCTCTCTGGCTATGGCAGG + Intergenic
1122424591 14:101598472-101598494 TCCACCAGTCAGGGTCTGGCAGG - Intergenic
1123448099 15:20344095-20344117 AGGACGCCTCTGGATCTGGCTGG - Intergenic
1123467174 15:20526081-20526103 CCCCCACCTCTGGACCTGGCTGG - Intergenic
1123650941 15:22474961-22474983 CCCCCACCTCTGGACCTGGCTGG + Intergenic
1123741349 15:23283803-23283825 CCCCCACCTCTGGACCTGGCTGG + Intergenic
1123745648 15:23318755-23318777 CCCCCACCTCTGGACCTGGCTGG - Intergenic
1123987299 15:25657075-25657097 TCCACCCCTCCGGATCCGGCAGG + Intergenic
1124277920 15:28342072-28342094 CCCCCACCTCTGGACCTGGCTGG - Intergenic
1124304781 15:28569536-28569558 CCCCCACCTCTGGACCTGGCTGG + Intergenic
1124421225 15:29524709-29524731 GACACCCCTCTAGATCTGGCAGG - Intronic
1125066035 15:35487092-35487114 TCTACCCCTGTGGATCTGTAGGG + Intronic
1126153882 15:45547349-45547371 TCCCCCCCTCCAGATCCGGCAGG - Intergenic
1126728335 15:51655590-51655612 TCCATCCCTCCGGATCCGGCAGG - Intergenic
1127074512 15:55312191-55312213 TCCATCCCTCCGGATCCAGCAGG - Intronic
1127867661 15:63044708-63044730 TCCACCCCTTAAGATCTGCCTGG + Intronic
1128363105 15:66976438-66976460 TCCACCCCTCCGGATCCAGCAGG - Intergenic
1129163857 15:73764087-73764109 TACACCCCTCTGGATATGGAAGG + Intergenic
1129776371 15:78239283-78239305 GCCATCCGTCTGGATCCGGCAGG - Intronic
1129829969 15:78662175-78662197 CCCACCCTGCTGGCTCTGGCAGG - Intronic
1130825965 15:87546648-87546670 TCTGTCCCTCTGGATCCGGCAGG - Intergenic
1130913749 15:88289147-88289169 TCTTTCTCTCTGGATCTGGCTGG + Intergenic
1131420116 15:92298311-92298333 TCCATCCCTCCAGATCTGGCAGG + Intergenic
1131629148 15:94157690-94157712 TCCACTCCTCCAGAGCTGGCAGG + Intergenic
1131673853 15:94651184-94651206 TCCATCCCTCTGGATCCAGCAGG + Intergenic
1131726773 15:95234998-95235020 TCCACCCCTGTGGCTCTGCAGGG + Intergenic
1138523951 16:57591061-57591083 TCCTCCCCACAGGGTCTGGCGGG + Intronic
1139188276 16:64832882-64832904 TCCACCCCTGTGGCTCTGCAGGG - Intergenic
1139484615 16:67248691-67248713 CGCACCGCTCTGGATCTGGTGGG + Intronic
1140869414 16:79092857-79092879 TCCACTCCTATGGAGCTGGGGGG - Intronic
1141275426 16:82583435-82583457 GCCACCCCTTTGAATCTGGCAGG - Intergenic
1141298461 16:82791641-82791663 TCCACCCCTCTGGATCCAGCAGG + Intronic
1142354667 16:89596838-89596860 TCCACCCACCTGGCTCAGGCAGG - Exonic
1142635794 17:1256812-1256834 TCCACCCGCCAGGAGCTGGCCGG - Intergenic
1142885560 17:2910289-2910311 TCCACTCCTCTGCTTCTGGCTGG + Intronic
1142909842 17:3079681-3079703 TCCACCCCTGTGGCTCTGCAGGG + Intergenic
1142924660 17:3224128-3224150 TCCACCCCTGTGGCTCTGCAGGG - Intergenic
1143380397 17:6492445-6492467 TCCTCCCCTCAGGAGCTGACAGG + Intronic
1144842409 17:18195665-18195687 TCCACCCATCTTGCTCAGGCTGG + Intronic
1145013951 17:19384981-19385003 TCAACCCTTCTGGATCTGGAAGG - Intronic
1148826724 17:50399281-50399303 TCCACCCCTCTGGATCTGGCAGG - Intergenic
1148834853 17:50460669-50460691 TCCACCTCTCTGGAACTGTAGGG - Exonic
1150963162 17:69937046-69937068 TCCAGCACTCTGGGGCTGGCAGG + Intergenic
1151017853 17:70577631-70577653 TCCACACCCCCGGATCCGGCAGG + Intergenic
1151224451 17:72638394-72638416 TCCACCCCTCCAGATCCAGCAGG + Intergenic
1151357332 17:73567618-73567640 TCCACCCCTCTGGCTTTGTAAGG - Intronic
1152575195 17:81136790-81136812 TGCAACCCTCTGGCTCTGGCTGG - Intronic
1153400781 18:4682091-4682113 TCTGTCCCTCTGGATCTGGCAGG + Intergenic
1153402062 18:4692049-4692071 TCCATCCCTTCGGATCCGGCAGG + Intergenic
1155707778 18:28837903-28837925 TCCACCCCTGTGGCTCTGCATGG + Intergenic
1155749234 18:29399195-29399217 TCCATCCCTCCGGATCCAGCAGG - Intergenic
1156407481 18:36796763-36796785 ACCACCACTCTGGAGCTGGTAGG + Intronic
1156892401 18:42205150-42205172 TCCACCCCTGTGGATTTGCAGGG - Intergenic
1158468709 18:57714523-57714545 TCCACCCCCCTAGCTCTGGGTGG + Intronic
1159390732 18:67789027-67789049 TCCATCCCCCTGGATCTGAGGGG + Intergenic
1159555561 18:69941415-69941437 TCCACCCCTCTGGCTATGCAGGG - Intronic
1159952590 18:74496232-74496254 ACCACCCCTCTGCCTGTGGCTGG + Exonic
1160011773 18:75111425-75111447 TCAACCCCTTTAGATCTGGGGGG + Intergenic
1163447019 19:17352891-17352913 TCCACCCCTCTGCCCCTGCCAGG + Intronic
1164173175 19:22745566-22745588 TCCACCCCTCCAGATCCAGCAGG + Intergenic
1164214179 19:23129357-23129379 TCCACCCCTGTGGCTCTGCAGGG - Intronic
1165375837 19:35441082-35441104 TCCACCCCCCAGGATGTGCCAGG + Intergenic
1165601449 19:37058413-37058435 TCCTCCCCTCTGCTTCTGGATGG + Intronic
1165823200 19:38690310-38690332 TCCACCCCTCCGGATCCAGCAGG + Intronic
1167289389 19:48616002-48616024 TTCACCCTCCTGGATCTGGGAGG - Intronic
1168292189 19:55362173-55362195 CAGTCCCCTCTGGATCTGGCCGG + Intronic
1168712762 19:58511379-58511401 TCCAGCCCTGTGTATGTGGCTGG - Exonic
924973615 2:153856-153878 TCCACCCCTCCGGATCCAACAGG - Intergenic
924974502 2:160340-160362 TCCACCCCTCCGGATCTGACAGG - Intergenic
925189797 2:1873915-1873937 TCCACCCCTCTCCATCTGGGTGG - Intronic
925516589 2:4690233-4690255 TCCACCCCTGTGGCTCTGCAAGG + Intergenic
926239159 2:11071473-11071495 TCCTCCCCTCTGCAAATGGCTGG - Intergenic
926769067 2:16351823-16351845 TCCACCCCTGTGGCTCTGCAGGG - Intergenic
926863993 2:17339351-17339373 TCCATTCTTCTGGATCTAGCAGG + Intergenic
928319128 2:30269306-30269328 TCCATCCCTCTGGATCTAGCAGG + Intronic
928440107 2:31285136-31285158 TCCACCCCTCCGGATCCAGCAGG + Intergenic
928671900 2:33610986-33611008 TCCACCCCTCCGGATCCAGCAGG - Intergenic
928676637 2:33657587-33657609 TTCACCCCTCCGGATCTGGCAGG + Intergenic
928773662 2:34732739-34732761 TCCATCCCTCTGGATCCAGCAGG - Intergenic
930485721 2:52008255-52008277 TCCACCCCTCCAGATCTGGCAGG + Intergenic
931109828 2:59098570-59098592 TCCACCCCTGTGGCTCTGCAGGG + Intergenic
931321537 2:61177918-61177940 CCCACCCCTCTGGATGTTTCGGG + Exonic
932060760 2:68495495-68495517 TCCACCCCTCTGGCTTTGGAGGG + Intronic
932917182 2:75872099-75872121 TCTATCCCTCCGGATCCGGCAGG + Intergenic
932923357 2:75942279-75942301 TCCACCCCTGTGGTTCTGCAGGG - Intergenic
933121765 2:78547003-78547025 TCCACCCCTCTGGATCTGGCAGG - Intergenic
933328835 2:80871733-80871755 CCCATCCCTCTGGATCCAGCAGG + Intergenic
933556334 2:83835379-83835401 TCCATCCCTCTGGATCCTGCAGG - Intergenic
934672428 2:96223137-96223159 TCCACCCCTCCAGATCCAGCAGG - Intergenic
935748353 2:106209373-106209395 TCCACCCCTCCGGATCCAGCAGG + Intergenic
936157447 2:110057650-110057672 TCCACCCCTGTCGATCTGGCAGG - Intergenic
936157465 2:110057756-110057778 TCCACCCCTGTCGATCTGGCAGG - Intergenic
936187227 2:110313688-110313710 TCCACCCCTGTCGATCTGGCAGG + Intergenic
936187245 2:110313794-110313816 TCCACCCCTGTCGATCTGGCAGG + Intergenic
936387732 2:112044802-112044824 TCCATCCCTCTGGATCCAGCAGG - Intergenic
936928272 2:117760471-117760493 TCCTGCCCTCTGGAGCTTGCTGG - Intergenic
937028600 2:118719616-118719638 CCCACCCCTCTGAATCTTGAAGG + Intergenic
937594975 2:123661614-123661636 TCCACCCCTCCAGATCTGGCAGG + Intergenic
938010999 2:127828839-127828861 TCCACCCCTGTGGTTTTGCCGGG - Intergenic
939134080 2:138273474-138273496 TCCATCCCTCTGGATCCAGCAGG - Intergenic
939419192 2:141944008-141944030 TCCTCCCCTCTGCAAATGGCAGG + Intronic
939494099 2:142907455-142907477 CCCACCCCTCTGGATCTGGCAGG - Intronic
939824470 2:146998546-146998568 TCTATCCCTCCGGATCCGGCAGG + Intergenic
940669048 2:156645186-156645208 CCCATCCCTCCGGATCTGGCAGG + Intergenic
941395558 2:164968865-164968887 TCCACTCCTCCGAATCTGGAAGG - Intergenic
942580688 2:177412965-177412987 TCCACCCCTCCAGATCCAGCAGG - Intronic
942679493 2:178462581-178462603 CCCATCCCTCTGAATCTGGCAGG + Intergenic
942830313 2:180232100-180232122 TCCACCCCTCAGGGTCCGTCAGG + Intergenic
943462362 2:188184643-188184665 TCCATGCCTCCGGATCTGGCAGG - Intergenic
944039786 2:195339895-195339917 TCCACCCCTCCGGATCTGGCAGG - Intergenic
944339093 2:198574316-198574338 TCCACTCCTTTGGTTCTGTCAGG + Intergenic
945064778 2:205939587-205939609 TCCATCCCTCCGGATCCAGCAGG + Intergenic
945395004 2:209306631-209306653 TCCATCCCTCCGGATCCAGCAGG + Intergenic
946937487 2:224736874-224736896 TCCACCCCTGTGGCTCTGTAGGG - Intergenic
947328144 2:229000023-229000045 TCCACCCCTGTGGCTCTGCAGGG - Intronic
947725810 2:232399627-232399649 TCCATCCCTGGGGAGCTGGCAGG - Intergenic
948517650 2:238514243-238514265 TCCACCCCTCTGGATCCGGCAGG + Intergenic
1168968308 20:1913457-1913479 TGTGCCCCTCTGGCTCTGGCTGG - Intronic
1169322485 20:4645060-4645082 TCCACCCCTCTGGATTTCTAGGG + Intergenic
1170741880 20:19065487-19065509 TCCACCCCTGTGGCTTTGGAGGG - Intergenic
1171500787 20:25591447-25591469 TCCATCCCTCCGGATCTGGCAGG - Intergenic
1172947202 20:38698790-38698812 TCCACCCCTCTGGATCAGGCAGG + Intergenic
1173276254 20:41586285-41586307 TTCACCCCTCCGGATCCGGCAGG + Intronic
1173649779 20:44655812-44655834 TCCTGCCCTCTGGCTCTGGTTGG + Intergenic
1175203977 20:57297192-57297214 TCCACCCCTTGGGAGCTGCCGGG + Intergenic
1175247449 20:57590422-57590444 CCCACCCCTCTGGCTCTGGAAGG - Intergenic
1176696047 21:9978837-9978859 TCCACCCCTCTGGCTCTGCAGGG - Intergenic
1177263004 21:18753080-18753102 CCCATCCCTCCGGATCCGGCAGG - Intergenic
1177263971 21:18760107-18760129 CCCATCCCTCCGGATCCGGCAGG - Intergenic
1177426360 21:20927709-20927731 TCCACCACTCCAGATCCGGCAGG + Intergenic
1177525769 21:22288017-22288039 TCCACCCCTGTGGCTTTGGAGGG - Intergenic
1177529392 21:22340504-22340526 TCCACCCCTGTGGCTCTAGAGGG + Intergenic
1177738131 21:25118821-25118843 TCCACCCCTCCGGATCCGGCAGG + Intergenic
1177895738 21:26854856-26854878 TCCATCCCTCTAGATCTGGCAGG + Intergenic
1177896710 21:26861690-26861712 TCCATCCCTCCAGATCTGGCAGG + Intergenic
1178154159 21:29832180-29832202 TCCACCCCTATGGATCTGCAGGG + Intronic
1178765881 21:35450615-35450637 TCCACCCCTGTGGCTTTGGAGGG + Intronic
1179843102 21:44090271-44090293 CCCGCCTTTCTGGATCTGGCTGG + Intronic
1179981084 21:44896384-44896406 TGCGCCCCTGTGCATCTGGCCGG - Intronic
1180924509 22:19544438-19544460 CACACCCCTCTGGGGCTGGCAGG + Intergenic
1181340030 22:22171518-22171540 TCCAGCCCTCTGGGAATGGCAGG - Intergenic
1182221366 22:28761590-28761612 TCCATCCCTCTGGATCCAGCAGG + Intergenic
1182895799 22:33858242-33858264 TCCATCCCTCTGGATCCAGCAGG - Intronic
1182945361 22:34316619-34316641 TCCACCCCTGTGGCTCTGCAGGG - Intergenic
1183688594 22:39375829-39375851 TCCTCCCCCCTGCATCTGGCTGG + Intronic
951016252 3:17735765-17735787 TCCACCCCTCCAGATCCAGCAGG - Intronic
951201167 3:19876428-19876450 CCCATCCCTCTGAATCTGGCAGG - Intergenic
951326068 3:21303089-21303111 TCCATCCCTCCAGATCCGGCAGG - Intergenic
951837650 3:27001181-27001203 TCCATCCCTCCAGATCTGGCAGG + Intergenic
952326450 3:32324707-32324729 ACCAACCCCCTGCATCTGGCTGG + Intronic
952921709 3:38289736-38289758 TCCACCCCTCCGGATCTGGCAGG - Intronic
952922691 3:38296883-38296905 TCCACCCCTCCGAATCTGGCAGG - Intronic
953515829 3:43591233-43591255 TCCATCCCTCCAGATCAGGCAGG + Intronic
954096962 3:48336055-48336077 TCCACACCTCCGGATTGGGCAGG - Intergenic
954329366 3:49881327-49881349 TTCTCCCCTGTGGATCAGGCTGG + Intergenic
955085505 3:55698520-55698542 TGCACTCCTTTGGATATGGCAGG - Intronic
955381270 3:58440178-58440200 TCCACCCCTCTGGATCCGGCAGG - Intergenic
955435422 3:58894546-58894568 TCCACCCCTGTGGCTCTGCAGGG + Intronic
955471840 3:59294603-59294625 TCCACCCCTGTGGCTCTGCAGGG + Intergenic
955833185 3:63026358-63026380 TCCACCCCTGTGGCTCTGCAGGG + Intergenic
956564248 3:70617528-70617550 TCCATCCCTCCAGATCTGGCAGG + Intergenic
957000500 3:74877899-74877921 TCCATCCCTCCGGATCCGGCAGG - Intergenic
957296905 3:78344225-78344247 TCCATCCCTCTAGATCCAGCAGG - Intergenic
957457704 3:80473163-80473185 TCCACCCCTCTGGCTTTGCAGGG - Intergenic
957687049 3:83515333-83515355 TCCATCCCTCCGGATGCGGCAGG + Intergenic
957895113 3:86412002-86412024 TCCACCCTTCTGGATCCGGCAGG + Intergenic
958016740 3:87946193-87946215 TCCACCCCTCTGGATCCGGCAGG - Intergenic
958091889 3:88886794-88886816 TCCACCCCTCTGGATCCGGCAGG - Intergenic
958457045 3:94345272-94345294 TCCACCGCTCCGGATCCGACAGG - Intergenic
958629241 3:96666788-96666810 ACCATCCCTCTGGATCCGGCAGG - Intergenic
958630362 3:96675006-96675028 TACATCCCTCCGGATCTGGCAGG - Intergenic
958823418 3:99002391-99002413 TCCACCCCTGTGGCTCTGCAGGG + Intergenic
959161768 3:102732774-102732796 TCCATCCCTCCGGATCCAGCAGG - Intergenic
959406348 3:105966207-105966229 TCCACCCTTCCAGATCCGGCAGG + Intergenic
959885713 3:111497358-111497380 TTCATCCCTCTGGATTTGGCAGG - Intronic
960494192 3:118355250-118355272 TCCACCCCTGTGGCTCTGCAGGG - Intergenic
960563794 3:119113572-119113594 TCCACCCCTGTGGCTCTGCAAGG + Intronic
960581514 3:119283006-119283028 TCCACCCCTGTGGCTCTGCAGGG - Intergenic
960672576 3:120167365-120167387 GCCAGCCTTCTGGTTCTGGCCGG - Exonic
960957784 3:123046459-123046481 TCCAGCCCTCAGGATGTGCCTGG - Intergenic
961831994 3:129627613-129627635 TCCACCCCGCTGCTTCTTGCCGG - Intergenic
962239033 3:133734855-133734877 TCCAACATTCTGGATTTGGCTGG - Intergenic
962636684 3:137338817-137338839 TCCACCCCTCTGGCTTTGCAGGG - Intergenic
963575891 3:147060195-147060217 TCCATCCCTCCAGATCTGGCAGG + Intergenic
963915317 3:150854416-150854438 TCCATCCCTCTGGATCTGGCAGG + Intergenic
964090798 3:152873798-152873820 TCCACCCCTCTGGCTTTGCAGGG + Intergenic
964853429 3:161119390-161119412 TCCACCCCTCTGGCTCTGCAGGG - Intronic
965036963 3:163451595-163451617 TCCACCCCTGTGGATTTGCAGGG - Intergenic
965054287 3:163694793-163694815 GTCACTCCTCTGGATCAGGCAGG - Intergenic
965342127 3:167503664-167503686 TCCATCCCTCTGGATCTGGCAGG - Intronic
966511217 3:180765630-180765652 TTCACCCCTCCGGATCCGGCAGG - Intronic
966626084 3:182018648-182018670 TGCTCCTCTCTGGATATGGCTGG - Intergenic
966994313 3:185265058-185265080 CCCACCCCTCCGGATCCGGCAGG + Intronic
967180767 3:186901737-186901759 CCCACCCCTGTGAATCTGACAGG - Intergenic
967389156 3:188938540-188938562 TCCATCCCCCTGGATCCCGCAGG - Intergenic
968390868 4:192100-192122 TCCAACCTTCTGGATCCAGCAGG - Intergenic
968530562 4:1089194-1089216 TCCACCCCTGTGGCTCTGTAGGG - Intronic
968884663 4:3321386-3321408 TCCACCCCACTCCATCTGGGAGG + Intronic
969083155 4:4635775-4635797 TCCACCCCATTGCCTCTGGCTGG - Intergenic
969644667 4:8420788-8420810 TCCACCCCTCCGGATCCAGCAGG + Intronic
970095533 4:12459591-12459613 TCCATCCCTGCGGATCCGGCAGG + Intergenic
970738108 4:19198096-19198118 TCCATCCCTCTGGATCCAGCAGG - Intergenic
971076783 4:23158420-23158442 TCCACCCTTCCGGATCTGGCAGG + Intergenic
971274410 4:25182344-25182366 TTCACCCCTCTGCAGCTGCCAGG - Intronic
972744627 4:41921223-41921245 TCCATCCCTGTGGATCTGCAGGG - Intergenic
972766766 4:42158525-42158547 TCCATCCCTCTGGATCTGGCAGG - Intergenic
972780831 4:42285706-42285728 TCCACCTCTGCAGATCTGGCAGG - Intergenic
972781773 4:42292455-42292477 CCCACCCCTGCGGATCTGGCAGG - Intergenic
972853846 4:43082263-43082285 TCCATCCCTCCAGATCTGGCAGG + Intergenic
973205064 4:47550805-47550827 TCCACCCCTGCGGATCTGGCAGG - Intronic
974190088 4:58493378-58493400 TCCATCCCTCCAGATCTGGCAGG - Intergenic
974190477 4:58496509-58496531 TCCACCCCTCTGGATCTGGCGGG - Intergenic
974469171 4:62296572-62296594 TCCACCCCTGTGGCTCTGCAGGG + Intergenic
974487287 4:62522474-62522496 TCTACCCCTCCGGATCCAGCAGG + Intergenic
974487845 4:62526852-62526874 TCCATCCCTCTGGATCTGGCAGG - Intergenic
974519965 4:62971438-62971460 TCCAGCCCTCCGGATCCGGCAGG + Intergenic
974520766 4:62977423-62977445 TCCACCCCTCCAGATCCAGCAGG + Intergenic
974556678 4:63460247-63460269 TCCACCCCTGTGGTTCTGCAGGG + Intergenic
974648493 4:64724939-64724961 ACCACCCCTCTGGATCCAGCAGG - Intergenic
974775660 4:66476922-66476944 TCCAAACCTCTGGATGGGGCAGG - Intergenic
974841801 4:67307640-67307662 TCCACCTCTCCAGATCCGGCAGG + Intergenic
975313221 4:72925982-72926004 TCCATCCCTCTGGATCCGGCAGG - Intergenic
975314186 4:72932744-72932766 TCCATCCCTCCGGATCTGGCAGG - Intergenic
975418814 4:74138633-74138655 TCCACTCCTCCGGATCCAGCAGG - Intronic
976189294 4:82473737-82473759 TCCACCCCTCCGGATCCAGCAGG + Intergenic
976190174 4:82479758-82479780 TCCACCCCTCCGGATCCGGCAGG + Intergenic
976464845 4:85355198-85355220 TCCACCCCTCCGGATCTGGCAGG - Intergenic
976636028 4:87287150-87287172 TCCACCCCTCTGGCTCTCTAGGG - Intergenic
976894878 4:90097341-90097363 TCCTCCTCTCTGGATGAGGCAGG - Intergenic
976949678 4:90813380-90813402 TCCACCCCTGTGGCTCTGTGGGG + Intronic
976963615 4:91009085-91009107 TCCATCCCTCCAGATCTGGCAGG - Intronic
977251326 4:94692670-94692692 TCCACCCCTCTGGATCCGGTAGG + Intergenic
977504835 4:97888346-97888368 TCCACCCCTTTGGCTCTGAAGGG - Intronic
977556182 4:98489623-98489645 TCCACCCCTCCGGATCCGGCAGG + Intronic
978587022 4:110284257-110284279 TCCATCCCTCCGAATCCGGCAGG - Intergenic
978909025 4:114044543-114044565 TCCATCCCTCCGGATCCAGCAGG + Intergenic
979610264 4:122682236-122682258 TCCACCCCTGTGGCTCTGCAGGG - Intergenic
979805078 4:124961065-124961087 TCCACCCCTGTGGCTCTGCAGGG + Intergenic
979885720 4:126025234-126025256 TCCACCCCTCTGGCTCTTTAGGG - Intergenic
979910835 4:126363717-126363739 TCCATCCCTCCAGATCTGGCAGG + Intergenic
980190525 4:129519370-129519392 TCCATCCCTCTGGATCCCGCAGG + Intergenic
980368662 4:131839065-131839087 TCCACCCCTCTGGCTCTGCAGGG - Intergenic
980406979 4:132366303-132366325 TCCACCCCTGTGGCTCTGCAGGG + Intergenic
980479365 4:133367263-133367285 TCCTCCCCTCTGCAAATGGCAGG - Intergenic
980523656 4:133961758-133961780 TCCACCCCTCCAGATACGGCAGG + Intergenic
980625722 4:135372343-135372365 TCCATCCCTCTGGTTCCAGCAGG + Intergenic
980683943 4:136201412-136201434 TCCATCCTTCCGGATCTGGCAGG + Intergenic
980871966 4:138622093-138622115 TCCACCCCTCCAGATCCAGCAGG - Intergenic
981740764 4:147999479-147999501 TCCATCCCTCCGGATCCGGCAGG + Intronic
982805307 4:159755490-159755512 TCCACCCCTATGGCTCTGCAGGG - Intergenic
983379152 4:166968914-166968936 TCCACCCCTGTGGCTCTGCAGGG - Intronic
983777801 4:171629925-171629947 TCCATCCCTCTGGATCCGGCAGG + Intergenic
984232072 4:177111942-177111964 TCCACCCCTGTGGATTTGCAGGG + Intergenic
984699761 4:182811345-182811367 TCCACCCCTGTGGTTCTGCAGGG + Intergenic
985350743 4:189058690-189058712 TTCTCCCCTCCGGATCTGGCAGG + Intergenic
985852538 5:2399087-2399109 ATCACCCCTCTGACTCTGGCAGG - Intergenic
986492612 5:8307803-8307825 TCCACACCTCAGGATCCGGCAGG - Intergenic
986557723 5:9027772-9027794 TCCACCCCTGTGGCTCTGCAGGG - Intergenic
987000122 5:13651751-13651773 TCCACCCCTGTGGCTTTGGAGGG - Intergenic
987129617 5:14848565-14848587 TCCACCCCTCCAGATTCGGCAGG + Intronic
987502698 5:18733523-18733545 TCCATCCCTTCGGATCCGGCAGG - Intergenic
987508232 5:18800469-18800491 TCCATCCCTCCGGATCCGGCAGG + Intergenic
987545854 5:19309599-19309621 TCCACCCCTGTGGCTCTGGAAGG + Intergenic
987655098 5:20796770-20796792 TCCACCCCTATGGCTCTGCAGGG + Intergenic
987719409 5:21615309-21615331 TCCACCCTTCTGGATCTGGCAGG - Intergenic
987761177 5:22164440-22164462 TCCATCCCTCAGGATCCAGCAGG - Intronic
987855130 5:23411345-23411367 TCCACCCCTCCGGATCCAGCAGG + Intergenic
987934901 5:24451246-24451268 TCCACCCCTCCAGATCCGGCAGG - Intergenic
987934912 5:24451313-24451335 TCCACCCCTCCGGATCCAGCAGG - Intergenic
988099680 5:26660307-26660329 TCCACCCCTCCGGATCTGACAGG - Intergenic
988147714 5:27331370-27331392 TCCACCCCTGTGGCTCTGGAAGG - Intergenic
988182548 5:27816270-27816292 TCCACCCCTCTGGATCCCGCAGG - Intergenic
988768464 5:34407132-34407154 TCCACCCCTATGGCTCTGCAGGG - Intergenic
988957391 5:36332935-36332957 TCCATCCTTCTGGATCCAGCAGG - Intergenic
989717704 5:44483537-44483559 TCCACCCCTCTGGATCCGGAAGG + Intergenic
990081619 5:51922764-51922786 TCTAGCCCTCTCGTTCTGGCTGG + Intergenic
990478810 5:56187586-56187608 TCTATCCCTCTGGATCCAGCAGG + Intronic
990741380 5:58915965-58915987 TCTATCCCTCTGGATCTGGCAGG + Intergenic
990789044 5:59455748-59455770 TCCACCCCTGTGGCTCTGCAGGG - Intronic
990891814 5:60658916-60658938 TCCACCCCTCCGGATCCAGCAGG + Intronic
990892811 5:60666122-60666144 TCCACCCCTCCAGATCCGGGAGG + Intronic
990905185 5:60795660-60795682 TCCAACCCTCCGGATCCGGCAGG + Intronic
991895967 5:71397894-71397916 TCCATCCCTCAGGATCCAGCAGG - Intergenic
992080387 5:73230773-73230795 TCCACGCCTCTAGAACTAGCTGG + Intergenic
992293502 5:75304615-75304637 TCCACCCCTCTGGATCTGGCAGG + Intergenic
992756296 5:79909690-79909712 TCCATCCTTCTGGAAATGGCTGG - Intergenic
992857283 5:80875492-80875514 TTCTCCCCTCTGGGGCTGGCAGG + Intronic
993054983 5:82970943-82970965 TCCATCCCTCCGGATCCAGCAGG - Intergenic
993460752 5:88177685-88177707 CCCATCCCTCCAGATCTGGCAGG - Intergenic
993622819 5:90188233-90188255 TCCACCCCTCTGGATCCAGCAGG - Intergenic
993941850 5:94068347-94068369 TCCACCCCTCCGGATCTGGCAGG - Intronic
993946547 5:94122694-94122716 TCCACCCCTGTGGCTTTGCCGGG + Intergenic
993982343 5:94557937-94557959 TCCATCCCTCTGGATCTGGCAGG + Intronic
994549199 5:101208964-101208986 TCCACCCCTGTGGCTCTGCCAGG - Intergenic
995466158 5:112451138-112451160 TCCATCCCTCCAGATCTGGCAGG + Intergenic
995717284 5:115092661-115092683 TCCACCCCTCCGGATCTGGCAGG + Intergenic
995785075 5:115819045-115819067 TCCACCCCTCCAGATCCGGCAGG - Intergenic
996049964 5:118921191-118921213 TCCACACCTCTGGATCTTTTTGG - Intronic
996126191 5:119727902-119727924 TCCACCCCTGTGGCTCTGCAGGG - Intergenic
996128278 5:119751570-119751592 TCCATCCCTCCAGATCCGGCAGG + Intergenic
996939809 5:128990897-128990919 TCCACCCCTCCAGATCCAGCAGG - Intronic
998665970 5:144297980-144298002 TTCATCCCTCTGGATTCGGCAGG + Intronic
999068466 5:148716860-148716882 TCCACCCCTGTGGCTCTGCAGGG - Intergenic
999151423 5:149428824-149428846 TCCACCTCTCCAGCTCTGGCCGG - Intergenic
1000095458 5:157967415-157967437 TCCATCCCTCCGGAACCGGCAGG + Intergenic
1001559703 5:172661008-172661030 TTGGCCCCTCTGGATATGGCGGG + Intronic
1001597150 5:172905653-172905675 TCCACCCCTCTGGATCCGGCAGG - Intronic
1004007317 6:11649082-11649104 TCCACCCCTCTGGATCCGTCAGG + Intergenic
1004236364 6:13878501-13878523 TCCACCCCTCCAGATCCAGCAGG + Intergenic
1004256418 6:14068853-14068875 TCCATCCCTCCGGATCTGGCAGG + Intergenic
1004785509 6:18963657-18963679 TCCCCACCTCTGGATGTCGCAGG - Intergenic
1008582769 6:52921472-52921494 TCCATACCTCTGGATCCAGCAGG - Intergenic
1009023938 6:57975009-57975031 TCCACCCATCTGGATCCAGCAGG + Intergenic
1009519542 6:64664029-64664051 TCCATCCCTCCAGATCGGGCAGG - Intronic
1009544327 6:65005155-65005177 TCCATCCCTTGAGATCTGGCAGG + Intronic
1009605046 6:65857054-65857076 TCCACCCCTCTGGCTTTGCAGGG + Intergenic
1009702465 6:67201759-67201781 TCCACCCCTCTGGATATCGCAGG + Intergenic
1009885212 6:69617070-69617092 TCAACCCCTCTGGATCTGGCAGG + Intergenic
1010345098 6:74801262-74801284 TCCACCCCTGTGGCTCTGCAGGG - Intergenic
1010569140 6:77456707-77456729 TCCACCCATCGGCCTCTGGCTGG - Intergenic
1010895034 6:81351523-81351545 TCCATTCTTCCGGATCTGGCAGG + Intergenic
1011189081 6:84712022-84712044 TCCACCCCTCTGGATCTGGCAGG - Intronic
1011310059 6:85971797-85971819 TACACCCCTCTGGACCTGGGTGG - Intergenic
1011540385 6:88421314-88421336 CCCATCCCTCTGAATCCGGCAGG - Intergenic
1012120021 6:95354775-95354797 TCCACCCCTCCGGATCCAGCAGG + Intergenic
1012734534 6:102921657-102921679 TCCATCCCTCCGGATCTGGCAGG - Intergenic
1013021762 6:106228300-106228322 TCCATCCCTCTGGATCTAGCAGG + Intronic
1013410513 6:109879645-109879667 TCCACCCCTCTGGATCTGGCAGG + Intergenic
1013543080 6:111131183-111131205 TCCACCCCTCTGGATCCGGCAGG + Intronic
1014043012 6:116851094-116851116 TCCACCCCTGTGGCTCTGCAGGG - Intergenic
1014133924 6:117866249-117866271 TCCACCCCTGTGGCTTTGCCAGG + Intergenic
1014208918 6:118687798-118687820 TCCATCCCTCCAGATCTGGCAGG + Intronic
1014243346 6:119041703-119041725 TCCACCCCTCCGGATCCGGCAGG + Intronic
1014407521 6:121069445-121069467 TCCACCCCTCTGGCTTTGCAGGG - Intergenic
1014634604 6:123829649-123829671 CCCACCCCTCTGCATTTAGCTGG - Intronic
1015605730 6:134953051-134953073 TCCACCCCTTGGGATGTGGTGGG - Intergenic
1015632771 6:135247990-135248012 TCCACCCCTCTGGATCCAGCAGG + Intergenic
1015795741 6:137009412-137009434 TCCACTTCTCTGGAGCTGTCAGG + Exonic
1016108228 6:140188818-140188840 TCCACCCCTGTGGCTCTGATGGG - Intergenic
1016264276 6:142213344-142213366 TCCACCCCTGTGGCTCTGCAGGG + Intronic
1016444920 6:144121378-144121400 TCCACCCCTCCGGATCCAGCAGG - Intergenic
1016632606 6:146249858-146249880 TCCACCCCTGTGGCTCTGCAGGG - Intronic
1017868999 6:158470200-158470222 CCCATCCCTCCGAATCTGGCAGG - Intronic
1018760556 6:166891238-166891260 TCCATCCCTCCGGATCCTGCAGG + Intronic
1018770882 6:166970757-166970779 TCCATCCTTCTGAATCTGGGAGG + Intergenic
1019776406 7:2914156-2914178 CCCACCCCGCTGGCCCTGGCTGG - Intronic
1020579085 7:9971641-9971663 TCTACCCCTGTGGATCTGTAGGG - Intergenic
1020906213 7:14067256-14067278 TCCATCCCTCCAGATCTGGCAGG + Intergenic
1021144259 7:17065946-17065968 TCCACCCCTCCAGATCGGGCAGG + Intergenic
1021525153 7:21578439-21578461 TCCACCCCTGTGGCTCTGCAGGG + Intronic
1021885335 7:25131907-25131929 TCCATCCCTCCGGATCCAGCAGG - Intergenic
1023018342 7:35987375-35987397 GCCTCCCCTCTGCATCTGGCGGG - Intergenic
1023282927 7:38590339-38590361 TCTACCCCTCCAGATCTGGCAGG - Intronic
1023438996 7:40167776-40167798 TCCACCCCTCCAGATCTGGCAGG - Intronic
1023439767 7:40173322-40173344 TCCACCCCTCCGGATCTGGCAGG - Intronic
1023733130 7:43210798-43210820 TCCACCCCTCTGGATCTGGCAGG - Intronic
1026346976 7:69482851-69482873 TCCACCCCTCCAGATCCGGCAGG + Intergenic
1026602114 7:71785581-71785603 TGCACCCCTATGGATGTGGTTGG + Exonic
1026788450 7:73316768-73316790 TCCTGCACTGTGGATCTGGCTGG - Intronic
1027254898 7:76425030-76425052 CCAACCCCTCTGGCTCTTGCAGG + Exonic
1027306259 7:76901119-76901141 TCCACTCTCATGGATCTGGCAGG - Intergenic
1027677957 7:81182297-81182319 TTTACCCCTCCGGATCTGGCAGG - Intronic
1027868358 7:83675030-83675052 TCCATACCTCCGGATCCGGCAGG - Intergenic
1028099138 7:86798320-86798342 TCCACCCCTCTGGCTTTGTAGGG - Intronic
1028147061 7:87330028-87330050 TCCACCCCTCTGGATCCAGCAGG - Intergenic
1028587720 7:92468265-92468287 CCCATCCCTCTGGATCATGCAGG - Intergenic
1028589083 7:92477752-92477774 CCCATCCCTCTGGATCCTGCAGG - Intronic
1028814711 7:95130673-95130695 TCCACCCCTGTGGCTCTGTAGGG - Intronic
1028926145 7:96358677-96358699 TCCACCCCTCTGGATCCGGCAGG - Intergenic
1028993392 7:97074836-97074858 TCCATCCCTCCGGATCCGACAGG + Intergenic
1029015976 7:97315977-97315999 TCCATCCCTCTGGATCTGGCAGG + Intergenic
1030336813 7:108337450-108337472 TCCATCCCTCTGGATCTGGCAGG + Intronic
1030431260 7:109452223-109452245 TCCACCCCTCCGAATCCCGCAGG + Intergenic
1030843974 7:114386115-114386137 CCCATCCCTCTGGATCCGGCAGG - Intronic
1031250870 7:119378910-119378932 TCCACCCCTCTGGATCCGGCAGG - Intergenic
1031299580 7:120047510-120047532 TCCATCCCTCCAGATCCGGCAGG + Intergenic
1031472004 7:122177235-122177257 TCCACCCCTCCGGATCCATCAGG + Intergenic
1031742820 7:125455899-125455921 TCCATCCCTCCGGATCCGGCAGG - Intergenic
1032318329 7:130861504-130861526 TCCACCCCTGTGGATTTGCAGGG - Intergenic
1032425785 7:131821158-131821180 CCCACCCCTCTGGATCCGGCAGG - Intergenic
1032653849 7:133906730-133906752 TCCATCCCTCCAGATCCGGCAGG + Intronic
1032725347 7:134585843-134585865 TCCACCTCTCTGGATCAGGCAGG + Intergenic
1032726299 7:134592676-134592698 TCCACCTCTCTGGGTCCAGCAGG + Intergenic
1034248773 7:149671741-149671763 TCCACCCCTCTGGATCTGGCAGG + Intergenic
1034249501 7:149676861-149676883 TCCACCCTTCTGGATCCAGCAGG + Intergenic
1034650838 7:152688821-152688843 TCCATCCCTCCGGATCCGGCAGG - Intergenic
1034707072 7:153155164-153155186 TCCACCCCTCTGGATTTGGCAGG - Intergenic
1034965005 7:155385366-155385388 TCCATCCCTCCGGATCCAGCAGG - Intronic
1035036612 7:155899595-155899617 TCCACCCCTTGTGAGCTGGCAGG - Intergenic
1036045546 8:5135818-5135840 TCCACCCATCTGGGCCTGCCAGG + Intergenic
1036542786 8:9735063-9735085 TCAACCCCTCTGCACCTGGCAGG + Exonic
1037379953 8:18274616-18274638 TCCACCCCTCAGGATCCAGCAGG - Intergenic
1037570609 8:20154880-20154902 TCCACCCCTCCAGATCTGGCAGG + Intronic
1037648685 8:20817020-20817042 TCCATCCCTCCGGATCCGTCAGG - Intergenic
1038742245 8:30225902-30225924 TCCATCCCTCTGGATCCGGCAGG - Intergenic
1039928132 8:41957880-41957902 TCCCCAACTCTGGATCTGGTAGG + Intronic
1040768448 8:50944261-50944283 TCCACCCCTCCGGATCCAGCAGG - Intergenic
1041664088 8:60425332-60425354 TCCACCCCTCGGGATCCGGCAGG - Intergenic
1042055660 8:64763121-64763143 TCCACCCCTCCGGATCCAGCAGG + Intronic
1042292933 8:67188699-67188721 TCCACCCCTCCGGATCTGGCAGG + Intronic
1043214539 8:77569470-77569492 TCCACCCCTGTGGCTCTTCCAGG + Intergenic
1044839137 8:96323165-96323187 TCCACCCCTGTGGCTGTGCCGGG + Intronic
1044988286 8:97774157-97774179 TCCACCCCTCTGGATCCGGCAGG - Intergenic
1045657595 8:104403160-104403182 TCCATCTCTCCAGATCTGGCAGG + Intronic
1045664327 8:104468972-104468994 TCCACCCCTCTGAATCCAGCAGG + Intergenic
1045863509 8:106839350-106839372 CCCACCCCTCAGGATCCGGCAGG - Intergenic
1046141247 8:110095860-110095882 TCCTCCCATCTAGATCTGCCAGG + Intergenic
1047407532 8:124597839-124597861 TCCTCTCCTCTGGTTCTGTCTGG - Intronic
1047443555 8:124900101-124900123 TTCACCCCTCTGGATCTGGCAGG - Intergenic
1047599740 8:126413926-126413948 TCCACCCCTCCAGATCCGGTAGG - Intergenic
1047618318 8:126581367-126581389 TCCACCCCTCCGGATCTGGCAGG + Intergenic
1047631077 8:126709104-126709126 TGCACACATCTGGGTCTGGCTGG - Intergenic
1048043273 8:130750872-130750894 TCCACCCCTGTGGGTCTGCAGGG + Intergenic
1048100252 8:131343186-131343208 TCCACCCTTCTGGATCCGGCAGG - Intergenic
1048789965 8:138093022-138093044 TCCACCCCTTTGGCTCTGCAGGG + Intergenic
1049257637 8:141622407-141622429 ACCACCCCTCTGTCTCTGGCAGG + Intergenic
1049433634 8:142576432-142576454 CCAAGCCCTCTGGATCTGGAAGG - Intergenic
1049489575 8:142888140-142888162 TCCACCCTTGTGGATCTGCAAGG + Intronic
1049525916 8:143126939-143126961 CCTACCCCTCTGGAGCTGCCAGG - Intergenic
1049846146 8:144802781-144802803 TGCTCCCTTCTGGATCTGGAGGG + Intronic
1050116053 9:2264561-2264583 TCCACCCCTCCGGATCCGGCAGG - Intergenic
1050593506 9:7183587-7183609 TCCATCCCTCTGGATCAGGCAGG + Intergenic
1051149127 9:14061659-14061681 TCCACCTCTCTGGACCTCTCTGG + Intergenic
1051970171 9:22878031-22878053 TCCATCCCTCCGGATCCAGCAGG - Intergenic
1051986649 9:23096937-23096959 TCCACCCCTCTGGCTTTGGAGGG - Intergenic
1052179326 9:25505279-25505301 TCCACCCCTGTGGTTCTGTGGGG + Intergenic
1053215198 9:36265055-36265077 TCCACCCCTCCGGATCTGGCAGG + Intronic
1053264189 9:36698662-36698684 TCCACCCCTGTGGCTCTGCAGGG + Intergenic
1053633028 9:39964789-39964811 TCCACCCCTCTGGCTCTGCAGGG - Intergenic
1053772723 9:41498744-41498766 TCCACCCCTCTGGCTCTGCCGGG + Intergenic
1054210860 9:62285908-62285930 TCCACCCCTCTGGCTCTGCAGGG + Intergenic
1054314124 9:63562946-63562968 TCCACCCCTCTGGCTCTGCAGGG - Intergenic
1055049590 9:71964992-71965014 TCCATCCCTCTGGATCCGGTAGG - Intronic
1055101060 9:72466254-72466276 CCCATCACTGTGGATCTGGCTGG + Intergenic
1055337525 9:75247630-75247652 TCCACCCCTGTGGCTCTGCCAGG - Intergenic
1055431337 9:76247178-76247200 TCCATCCCTCCAGATCAGGCAGG - Intronic
1055455702 9:76469651-76469673 TCCATCCCTCTGGATCAGGCAGG + Intronic
1056705007 9:88944237-88944259 TCCATCCCTCTGGATCTGGCAGG - Intergenic
1056763000 9:89428010-89428032 TCCACCCCTCAGGGCCAGGCGGG - Intronic
1056954489 9:91071421-91071443 GCCTCCCCTCTGGCCCTGGCCGG + Intergenic
1058762437 9:108147967-108147989 TCCTACTCTCTGGATCAGGCAGG - Intergenic
1061004267 9:127919540-127919562 TCCACCCATCTGGATCCCACAGG - Intergenic
1061801633 9:133116170-133116192 TCCACCCACCTGGAGCTGGAGGG - Intronic
1062408083 9:136407296-136407318 TCCACCCCGTCGGAGCTGGCAGG - Exonic
1203783961 EBV:116740-116762 TGCACCCTCCTGGACCTGGCCGG - Intergenic
1185560918 X:1060118-1060140 TCCACCCCTCCGGATCAGGCAGG + Intergenic
1186254530 X:7703881-7703903 TCCATCCCTCTGGATCCGGCAGG - Intergenic
1186742672 X:12534538-12534560 TCCACCCCTGTGGATTTGCAGGG - Intronic
1187582825 X:20626995-20627017 TCCCTCCCCTTGGATCTGGCAGG - Intergenic
1187603811 X:20861748-20861770 TCCACTCCTCTGGTTCTGCAGGG - Intergenic
1187613823 X:20971900-20971922 TCCATCCCTCAGGATCTGCCAGG + Intergenic
1188039669 X:25357444-25357466 TCCACCCCCTTGAATCTGGATGG + Intergenic
1188157317 X:26755944-26755966 CCACCCCCTCTGGATCCGGCAGG - Intergenic
1188889747 X:35595406-35595428 TCCACCCCTGTGGCTTTGGAGGG - Intergenic
1189025301 X:37388142-37388164 TCCACCCCTCTGGCTTTGCAGGG + Intronic
1189253681 X:39620972-39620994 TCCACCCCTGTGGCTCTGCAGGG + Intergenic
1189954270 X:46261957-46261979 TCCATCCCTCCGGATCTGGCAGG - Intergenic
1190240566 X:48654946-48654968 TCCATCCCTCCAGATCCGGCAGG + Intergenic
1190343590 X:49317251-49317273 TCACCTCCTCTGGATTTGGCAGG - Exonic
1190344680 X:49326778-49326800 TCACCTCCTCTGGATTTGGCGGG - Exonic
1190345773 X:49336335-49336357 TCACCTCCTCTGGATTTGGCGGG - Exonic
1190346877 X:49345885-49345907 TCACCTCCTCTGGATTTGGCGGG - Exonic
1190348126 X:49536912-49536934 TCACCTCCTCTGGATTTGGCGGG - Exonic
1190349227 X:49546468-49546490 TCACCTCCTCTGGATTTGGCGGG - Exonic
1190350331 X:49556024-49556046 TCACCTCCTCTGGATTTGGCGGG - Exonic
1190351433 X:49565583-49565605 TCACCTCCTCTGGATTTGGCGGG - Exonic
1190352533 X:49575136-49575158 TCACCTCCTCTGGATTTGGCGGG - Exonic
1190353634 X:49584684-49584706 TCACCTCCTCTGGATTTGGCGGG - Exonic
1190354736 X:49594206-49594228 TCACCTCCTCTGGATTTGGCGGG - Exonic
1190355841 X:49603756-49603778 TCACCTCCTCTGGATTTGGCGGG - Exonic
1190365458 X:49689433-49689455 TCACCTCCTCTGGATTTGGCAGG + Exonic
1190368109 X:49716716-49716738 TCCACCCCTCCAGATCCAGCAGG + Intergenic
1190466207 X:50727003-50727025 TCCACCCCTGTGGCTCTGTAGGG - Intronic
1191167480 X:57405516-57405538 TCCACCACTCTGGATCTGGCAGG - Intronic
1192254881 X:69448023-69448045 TCCACCCCTCCAGATCTGGCAGG + Intergenic
1192571980 X:72213584-72213606 TCCACCCCTCCAGATATGGCAGG + Intronic
1192803103 X:74485840-74485862 TCCACCCCTCCGGATCCGGCAGG - Intronic
1192961003 X:76130783-76130805 TCCACCCCTCCAGATCCAGCAGG + Intergenic
1193172381 X:78350329-78350351 TCCTCCCCTCTGGATCCAGCAGG - Intergenic
1193295488 X:79827524-79827546 TCCATCCCTCCGGATATGGCAGG - Intergenic
1193943866 X:87708619-87708641 TCCACCCCTCTGGCTTTGCAGGG + Intergenic
1194103275 X:89734543-89734565 TCCATCCCTCCGGATCCCGCAGG - Intergenic
1194154499 X:90370256-90370278 TCCATCTCTCTGGATCCGGCAGG - Intergenic
1194558194 X:95388633-95388655 GGCTCCCCTCTGGATCTAGCAGG + Intergenic
1194563064 X:95447065-95447087 TCCACCCCTGTGGCTCTGTAGGG + Intergenic
1194903454 X:99543404-99543426 TCCACCCCTGTGGCTCTGCAGGG - Intergenic
1195243674 X:102977855-102977877 TTCACCCCTCCGGATCCAGCAGG + Intergenic
1195256577 X:103096818-103096840 TCCACCCCTCCGGATCCAGCAGG + Intergenic
1195505076 X:105647191-105647213 TCCACCCCTCCGGATCTGGCAGG - Intronic
1195584610 X:106551435-106551457 TCCATCCCTCTGGATCTGGCAGG + Intergenic
1196258164 X:113547159-113547181 TCCATCGCTCCGGATCCGGCAGG - Intergenic
1196772520 X:119309112-119309134 TCCATCCCTCCGGATCCAGCAGG - Intergenic
1197524828 X:127548096-127548118 TCCACCCCTGTGGCTCTGCAGGG - Intergenic
1197545321 X:127816560-127816582 TCCATCCCTCCGGATCCGGCAGG - Intergenic
1197999711 X:132420303-132420325 TCCACCCCTCCAGATCCGGCAGG - Intronic
1198203550 X:134445362-134445384 CCCACCCCTCTGCACCTGCCAGG + Intergenic
1198566834 X:137913867-137913889 TCCATCCCTCCAGATCCGGCAGG - Intergenic
1198873796 X:141202201-141202223 TCCACCCCTGTGGCTCTGCAGGG - Intergenic
1199077841 X:143544835-143544857 TCCACCCCTATGGCTCTGCAGGG + Intergenic
1199117335 X:144008346-144008368 TCCACCCCTATGGCTCTGCAGGG + Intergenic
1199119648 X:144036317-144036339 GCCACCCCAGTGGGTCTGGCAGG + Intergenic
1200415976 Y:2910310-2910332 TCCACCCCTCCAGATCCAGCAGG - Intronic
1200500852 Y:3947149-3947171 TCCATCTCTCTGGATCCGGCAGG - Intergenic
1200762688 Y:7054628-7054650 TCCATCCCTCCAGATCTGGCAGG + Intronic
1200851259 Y:7886364-7886386 TCCACCCCTCTGGATCCAGCAGG - Intergenic
1201329236 Y:12800047-12800069 TCCACCCCTCCAGATCTGGCAGG + Intronic
1201421479 Y:13804588-13804610 TCCACCCCTCCAGATCCAGCAGG + Intergenic
1201642240 Y:16192157-16192179 TCCACCCCTCCAGATCTGGCAGG - Intergenic
1201660575 Y:16393164-16393186 TCCACCCCTCCAGATCTGGCAGG + Intergenic
1201723816 Y:17132993-17133015 TCCAACCCTCTGAATCTGGCAGG - Intergenic
1201724342 Y:17136690-17136712 TTAACCCCTCTGGTTCTGGCAGG - Intergenic
1201905234 Y:19080360-19080382 TCCATCCCTCTGGATCCAGCAGG + Intergenic
1202062378 Y:20900867-20900889 TCCATCCCTCCAGATCTGGTGGG + Intergenic