ID: 974190479

View in Genome Browser
Species Human (GRCh38)
Location 4:58496513-58496535
Sequence GACTTCCACCCCTCTGGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 28, 1: 72, 2: 82, 3: 94, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974190479_974190484 12 Left 974190479 4:58496513-58496535 CCAGATCCAGAGGGGTGGAAGTC 0: 28
1: 72
2: 82
3: 94
4: 145
Right 974190484 4:58496548-58496570 GCAACAATGGCGATCAGCAGTGG No data
974190479_974190485 15 Left 974190479 4:58496513-58496535 CCAGATCCAGAGGGGTGGAAGTC 0: 28
1: 72
2: 82
3: 94
4: 145
Right 974190485 4:58496551-58496573 ACAATGGCGATCAGCAGTGGTGG No data
974190479_974190483 -1 Left 974190479 4:58496513-58496535 CCAGATCCAGAGGGGTGGAAGTC 0: 28
1: 72
2: 82
3: 94
4: 145
Right 974190483 4:58496535-58496557 CAACAGCGGGTCTGCAACAATGG No data
974190479_974190486 19 Left 974190479 4:58496513-58496535 CCAGATCCAGAGGGGTGGAAGTC 0: 28
1: 72
2: 82
3: 94
4: 145
Right 974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974190479 Original CRISPR GACTTCCACCCCTCTGGATC TGG (reversed) Intergenic
900500380 1:3001602-3001624 CACCCCCACCCCTCAGGATCGGG + Intergenic
904397181 1:30229833-30229855 GACTTCCACCCCTCCGGATCCGG + Intergenic
905419885 1:37834129-37834151 GACCTCCACCTCCCTGGCTCAGG - Intronic
906507522 1:46391143-46391165 GACTTCCATCCCTCTGGATCCGG - Intergenic
907506068 1:54919103-54919125 GACTTCTATCCCTCTGAATCCGG - Intergenic
907602960 1:55788504-55788526 GACTTCCACCCCTCTGGATACGG - Intergenic
908383693 1:63620323-63620345 CACTTCAAGCCCTCTGGAACAGG + Intronic
908574401 1:65443887-65443909 GAGGTCCACCTATCTGGATCAGG + Intronic
908717667 1:67087559-67087581 GATTTCCACCCCTCCAGATCTGG + Intergenic
908723220 1:67148186-67148208 GACTTCCACCCCTCTGGATCCGG - Intronic
908892687 1:68863887-68863909 GACTTCCACCCCTCTGGATCCGG + Intergenic
910116675 1:83739168-83739190 GACTTCCATCCCTCTGGATCCGG - Intergenic
910590515 1:88924688-88924710 GACTTCCATCTCTCCAGATCCGG + Intergenic
912463398 1:109852554-109852576 GACTTCCGCCCCTCTGGATCCGG - Intergenic
913470777 1:119183088-119183110 GACTTCCAACCCTCTGGATCTGG - Intergenic
917097526 1:171414033-171414055 GACTTCCACCCCTTGGGATCTGG - Intergenic
917403527 1:174678889-174678911 GACTTCCATCCCTCCGGATAGGG - Intronic
917724030 1:177812805-177812827 GACTTCCACCCCTCCGGATCCGG + Intergenic
918525659 1:185461626-185461648 GAGTTCCACATCTGTGGATCTGG - Intergenic
919824888 1:201496386-201496408 GTCTTTCTCTCCTCTGGATCTGG - Intronic
920639846 1:207741476-207741498 GACTTCCATTCCTCCGGATCCGG - Intergenic
922007932 1:221551013-221551035 GACTTCCATCCCTCCAGATCAGG - Intergenic
922683926 1:227624835-227624857 GACTTCCATCCCTCTGGATCTGG - Intronic
922685153 1:227633120-227633142 GACTTCCACCCCTCCGGATCCGG - Intronic
922876311 1:228942554-228942576 GACTTCCATGCCTCCAGATCAGG + Intergenic
922877775 1:228953932-228953954 AACTTCCATCCCTCTGGATCTGG + Intergenic
1065222792 10:23513335-23513357 GACTTTCACCACTCCGGATCCGG - Intergenic
1066342889 10:34553174-34553196 GATTTCCACCACTCTGAACCTGG - Intronic
1066673010 10:37859415-37859437 GACTTCCATCCCTCCGGATCTGG - Intergenic
1067392458 10:45876433-45876455 GCCTTCCACCCAACTGAATCAGG + Intergenic
1067860783 10:49845548-49845570 GCCTTCCACCCAACTGAATCAGG + Intronic
1068191619 10:53659794-53659816 GACTTCCATCCCTCCGGATCCGG + Intergenic
1068791290 10:61034010-61034032 GACTTCCACCCCTCCGGATCTGG - Intergenic
1068792065 10:61039475-61039497 GACTTCCACCCCTCCGGATATGG - Intergenic
1071082698 10:81831270-81831292 GACTTCCGCCCCTCTGGATCTGG - Intergenic
1071326720 10:84525692-84525714 GACTTCCACCCCTCCGGATCTGG - Intergenic
1071327409 10:84530632-84530654 GACTTCCACCCCTCTGGATCTGG - Intergenic
1071331534 10:84565528-84565550 GACTTCCATCCCTCCAGATATGG - Intergenic
1071399229 10:85253276-85253298 GATTTTCAGCCCTCTGGATGGGG - Intergenic
1071557000 10:86612123-86612145 GACTTCCATCCCTCCGGTTCCGG + Intergenic
1072378557 10:94841350-94841372 GACTTCCATCCCTCCAGATCTGG - Intronic
1072650317 10:97290279-97290301 GACTCCCATCCCTCCGGATCTGG + Intronic
1075343263 10:121663893-121663915 GACTTCCCAGCCTCTGGAACTGG - Intergenic
1078146035 11:8722403-8722425 GACTCTGACCCCGCTGGATCAGG - Intronic
1078191866 11:9097730-9097752 GACTTCCACCCCTCCAGATCCGG + Intronic
1078268056 11:9769737-9769759 GAATTCCATGCCTTTGGATCAGG - Intergenic
1079601738 11:22317899-22317921 GACTTCCATCCCTCCGGATGCGG - Intergenic
1079934236 11:26597492-26597514 GACTTCAACCCCTCCAGATCCGG - Intronic
1081102064 11:39014642-39014664 GACCTCCACCTCTCAGGCTCAGG - Intergenic
1081141086 11:39501191-39501213 GTCTTCCACACCTCTGGGGCAGG + Intergenic
1082737610 11:56873942-56873964 GACTTCCACCCCTCCAGATCCGG + Intergenic
1083107007 11:60368082-60368104 GACTTCTACCCCTCCGGATCTGG + Intronic
1083420061 11:62547365-62547387 GATTTCCACCCCCCAGGAGCCGG + Intronic
1084560977 11:69905213-69905235 GAGTTCCACACCTCAGGGTCAGG - Intergenic
1084696434 11:70758381-70758403 GACTTCCACCCCTCCGGATCTGG + Intronic
1084878730 11:72154342-72154364 GACTTCCACCCCTCCAGATCTGG + Intergenic
1085267129 11:75243531-75243553 GACTCCCCACCCTCTAGATCAGG + Exonic
1085601986 11:77863300-77863322 GACTTCCATCCCTCCGGATCCGG - Intronic
1085621574 11:78041727-78041749 GACTCCCATCCCTCCGGATCTGG + Intronic
1085900972 11:80699528-80699550 GATTTCCACCCCTCCGGATCCGG - Intergenic
1086511204 11:87559879-87559901 GACTTCCACCCCTCCAGATCCGG - Intergenic
1087901296 11:103644850-103644872 GACTTCCACCCCTCCAGATCCGG - Intergenic
1088110101 11:106251177-106251199 GACGTCTATCCCTCTGGATCTGG + Intergenic
1088242931 11:107789671-107789693 GACTTCCACCCCTCCGGATCTGG + Intergenic
1088484618 11:110328704-110328726 GACTTCCACCACTCTGGATCAGG - Intergenic
1091039469 11:132263123-132263145 GACTGCCACCCCACTGGGTCTGG - Intronic
1091855096 12:3733025-3733047 GAATCCCAGCGCTCTGGATCCGG + Exonic
1092263471 12:6964253-6964275 GACCTTCACCCCTCTGGATGGGG + Intergenic
1092293647 12:7181308-7181330 GACTTCCACCCCTCCGGATCTGG + Intergenic
1093106657 12:15095419-15095441 GACTTCCATCCCTCTGGATCCGG - Intergenic
1094502850 12:31036201-31036223 GACCCCCACCCCTCTGCAGCAGG + Intergenic
1094641002 12:32275700-32275722 GACTCCCATCCCTCCAGATCCGG + Intronic
1095138580 12:38636662-38636684 CACTCCCACCCCTCCGGATCTGG + Intergenic
1095283468 12:40384049-40384071 GAATCCTACCCCTCCGGATCTGG + Intergenic
1095893107 12:47253020-47253042 GACTTCCATCCCTCCAGATCAGG - Intergenic
1096351229 12:50902819-50902841 GACTTCCATTCCTCTGGGTCCGG - Intergenic
1096352546 12:50912190-50912212 GACTTCCATCCCTCTGGATCTGG - Intergenic
1096939397 12:55325698-55325720 GACTTCCATCCCTCCAGATCTGG + Intergenic
1097840851 12:64320000-64320022 GACTTCCATCCCTCCGGATCCGG + Intronic
1098984878 12:77001490-77001512 GACTTCCACCCCTCCGGATCTGG + Intergenic
1099102478 12:78459669-78459691 GACTTCCATCACTCCAGATCTGG + Intergenic
1099605038 12:84794133-84794155 GACTTCCACCCCTCCGGATCCGG + Intergenic
1099798626 12:87429606-87429628 GACTTCCACCCCTCTGGATCCGG - Intergenic
1100205061 12:92339665-92339687 GACTTCCATGCCTCTGGATCTGG - Intergenic
1103802560 12:123548835-123548857 GACTTCCACCCCTCCGGATCTGG + Intergenic
1103804002 12:123558420-123558442 GACTTCTAGCCGTCCGGATCCGG + Intergenic
1103872336 12:124100800-124100822 AACTTCCACCCCTCCGGATCCGG - Intronic
1104476816 12:129077278-129077300 GACTGCTTCCCTTCTGGATCAGG - Intronic
1104850962 12:131873522-131873544 GACTTCCACCCCTCTGGATCCGG - Intergenic
1105430651 13:20334281-20334303 GACTCACACCACTCTGGAACAGG + Intergenic
1107156423 13:37172365-37172387 GACTTCCATCCCTCCGGATCCGG - Intergenic
1108876206 13:55054063-55054085 GACTCCCATCCCTCCAGATCCGG + Intergenic
1108877226 13:55061378-55061400 GACTCCCATCCCTCCAGATCTGG + Intergenic
1109520626 13:63505544-63505566 GACTTCCATCCCTCTGGATCCGG - Intergenic
1109680711 13:65748430-65748452 GACTTCCATCCCTCCGGATCCGG - Intergenic
1109931301 13:69222053-69222075 GACTCCCATCCCTCCGGATCCGG + Intergenic
1110846148 13:80192470-80192492 GACTTCCATCCCTCCGGATCTGG + Intergenic
1110987072 13:81984402-81984424 GACTTCCATCCCTCCAGATCCGG - Intergenic
1111021447 13:82457723-82457745 GACTCCCATCCCTCCGGATCCGG + Intergenic
1111090491 13:83439625-83439647 GACTTCCACCCCTAGGGATCGGG + Intergenic
1111536792 13:89612079-89612101 AACTTCCATCCCTCTGGATCCGG - Intergenic
1111709775 13:91796321-91796343 GACTTCCAACCCTCCAGATCCGG - Intronic
1111772916 13:92622098-92622120 AGCTTCCAGCCCTCTGGCTCTGG + Intronic
1111820402 13:93206934-93206956 GACTTCCATCCCTCCGGATCCGG + Intergenic
1112967731 13:105218683-105218705 GACATCAACCACACTGGATCAGG + Intergenic
1113534726 13:111056640-111056662 GACTTCCATCTCTCCAGATCCGG + Intergenic
1114383853 14:22236774-22236796 GACTTCCATCCCTCCAGATCTGG + Intergenic
1114384829 14:22243821-22243843 GACTTCCATCCCTCCAGATCCGG + Intergenic
1114397942 14:22383922-22383944 GACTTCCACCCCTCAGAAGAGGG - Intergenic
1114840845 14:26260623-26260645 GACTTCCATCCCTCCAGATCCGG + Intergenic
1115757571 14:36544479-36544501 GACTTCTATCCCTCCGGATCCGG - Intergenic
1117171815 14:53108166-53108188 GACTTCCATCCCTCCGGATCCGG + Intronic
1118453512 14:65925215-65925237 GACTCCCAACCCTCCGGATCCGG - Intergenic
1119089937 14:71772175-71772197 GACTTCCATCCCTCCAGATCTGG - Intergenic
1119936643 14:78598187-78598209 CACATCCACGCCTCTGGCTCTGG - Intronic
1120107980 14:80517936-80517958 GACTTCCACCCCTCTGGATCTGG - Intronic
1120397389 14:83985622-83985644 GACTTCCATCCCTCTGGATCCGG + Intergenic
1122379525 14:101291951-101291973 GAATTTCACCCCCCTGAATCTGG + Intergenic
1123987298 15:25657071-25657093 GACTTCCACCCCTCCGGATCCGG + Intergenic
1124421226 15:29524713-29524735 GACTGACACCCCTCTAGATCTGG - Intronic
1126153883 15:45547353-45547375 GACTTCCCCCCCTCCAGATCCGG - Intergenic
1126728336 15:51655594-51655616 GACTTCCATCCCTCCGGATCCGG - Intergenic
1127039470 15:54958338-54958360 TACTTCCAGTCCTATGGATCTGG + Intergenic
1129163856 15:73764083-73764105 TATTTACACCCCTCTGGATATGG + Intergenic
1129776372 15:78239287-78239309 GACTGCCATCCGTCTGGATCCGG - Intronic
1130825966 15:87546652-87546674 GACTTCTGTCCCTCTGGATCCGG - Intergenic
1131420115 15:92298307-92298329 GATTTCCATCCCTCCAGATCTGG + Intergenic
1131629147 15:94157686-94157708 GACTTCCACTCCTCCAGAGCTGG + Intergenic
1132947287 16:2538405-2538427 CACTTCCACCCCGCTGGGCCGGG - Intronic
1132968429 16:2673051-2673073 CACTTCCACCCCGCTGGGCCGGG + Intergenic
1134683873 16:16145439-16145461 TACTTCCACTCCCCTGGATGAGG - Intergenic
1137005832 16:35273791-35273813 GACTTACACCCCTTTTGACCTGG - Intergenic
1142198432 16:88749601-88749623 GGCTTCCACGGCTCTGGCTCAGG - Intronic
1142282130 16:89154190-89154212 CACTTCCACCCCTCATGACCCGG + Exonic
1145013953 17:19384985-19385007 TCCTTCAACCCTTCTGGATCTGG - Intronic
1148826725 17:50399285-50399307 GACTTCCACCCCTCTGGATCTGG - Intergenic
1148827587 17:50405263-50405285 GACTTCCACCCCTCCAGATCCGG - Intergenic
1149274552 17:55018317-55018339 GACTTCCATCCCTCTCAATCCGG - Intronic
1151017852 17:70577627-70577649 GACTTCCACACCCCCGGATCCGG + Intergenic
1153400780 18:4682087-4682109 GACTTCTGTCCCTCTGGATCTGG + Intergenic
1153402061 18:4692045-4692067 GGCTTCCATCCCTTCGGATCCGG + Intergenic
1154152071 18:11914230-11914252 GTCTTCCACCTCTCTGGCTTTGG + Intergenic
1154202171 18:12307682-12307704 GACTCCCACCCCTTTGGAACCGG - Intronic
1156662246 18:39359387-39359409 GACTTCCACCCCTCAGGGTTCGG - Intergenic
1157782199 18:50449472-50449494 GACTTCCATCCCTTCGGATTCGG - Intergenic
1159276124 18:66223477-66223499 GACTTCCATCCCTCCAGAACCGG + Intergenic
1160115694 18:76077323-76077345 GGATTCCACCCCACTGGATAGGG + Intergenic
1161306786 19:3573152-3573174 GACTTCCCTGCCCCTGGATCCGG + Intronic
1162371143 19:10280187-10280209 GACTTCCTCCCCGCTGCACCAGG + Intronic
1163901134 19:20101117-20101139 GACTTCCACCCCTCCCCCTCCGG + Intronic
1165601448 19:37058409-37058431 GACATCCTCCCCTCTGCTTCTGG + Intronic
1166014321 19:39968901-39968923 GACTTCCACCCCTCCGGATCCGG + Intergenic
1168148576 19:54432926-54432948 GCCTCCCACCCTTCTGGAACTGG + Intronic
926904804 2:17795696-17795718 GGGTTCCACCCCACTGGATTCGG + Intronic
927092713 2:19724281-19724303 GCCTTCCCCGCCTCTGGATCTGG - Intergenic
928013568 2:27633385-27633407 AACTTCCACCTCCCTGGCTCAGG + Intronic
928347682 2:30516365-30516387 GACTTTCACCGCTCTGGATCCGG + Intronic
928348193 2:30519920-30519942 GACTTTCACCCCTCTGGATCTGG + Intronic
928676636 2:33657583-33657605 GACTTTCACCCCTCCGGATCTGG + Intergenic
930158946 2:48133204-48133226 AACTTCCACCTCCCTGGCTCAGG - Intergenic
930485720 2:52008251-52008273 GACTTCCACCCCTCCAGATCTGG + Intergenic
931038985 2:58275792-58275814 GACTTCCATCCGTCCAGATCCGG + Intergenic
932917181 2:75872095-75872117 GACTTCTATCCCTCCGGATCCGG + Intergenic
933121766 2:78547007-78547029 GACTTCCACCCCTCTGGATCTGG - Intergenic
935172454 2:100620895-100620917 CACTTCTACACCTCTGCATCGGG + Intergenic
936157448 2:110057654-110057676 GACTTCCACCCCTGTCGATCTGG - Intergenic
936157466 2:110057760-110057782 GACTTCCACCCCTGTCGATCTGG - Intergenic
936187226 2:110313684-110313706 GACTTCCACCCCTGTCGATCTGG + Intergenic
936187244 2:110313790-110313812 GACTTCCACCCCTGTCGATCTGG + Intergenic
936868895 2:117109697-117109719 GATTTCCATCCCTCAGGATCCGG + Intergenic
937059372 2:118970343-118970365 GGCCTCCTCCCCTCTGGGTCAGG + Intronic
937594974 2:123661610-123661632 GACTTCCACCCCTCCAGATCTGG + Intergenic
939494101 2:142907459-142907481 GACTCCCACCCCTCTGGATCTGG - Intronic
939577759 2:143916648-143916670 GACTTCCCCGCCTCCGGAACTGG - Intergenic
939824469 2:146998542-146998564 GACTTCTATCCCTCCGGATCCGG + Intergenic
939909174 2:147959895-147959917 TACTTCTTCACCTCTGGATCAGG + Intronic
940669046 2:156645182-156645204 GACTCCCATCCCTCCGGATCTGG + Intergenic
940998693 2:160178413-160178435 GACTGCTACCTCTGTGGATCTGG - Intronic
941395559 2:164968869-164968891 GACTTCCACTCCTCCGAATCTGG - Intergenic
942679491 2:178462577-178462599 GACTCCCATCCCTCTGAATCTGG + Intergenic
943160421 2:184243006-184243028 GACTTCCACACCTCTGGCTAAGG - Intergenic
943462363 2:188184647-188184669 AACTTCCATGCCTCCGGATCTGG - Intergenic
944039787 2:195339899-195339921 GACTTCCACCCCTCCGGATCTGG - Intergenic
946159910 2:217829803-217829825 GACTTCCTGCTCTCTGGGTCTGG - Intronic
947033216 2:225821627-225821649 GACTTTCAGCTCTCTGGAACAGG + Intergenic
947931507 2:233968614-233968636 GACATGCACCCCTCTGGCCCTGG - Intronic
948517649 2:238514239-238514261 GACTTCCACCCCTCTGGATCCGG + Intergenic
1168904057 20:1390167-1390189 TACTTCCACCCCTCTTTCTCTGG + Intronic
1170057994 20:12228372-12228394 GACTTCCAGCCAACAGGATCTGG + Intergenic
1171500788 20:25591451-25591473 GACTTCCATCCCTCCGGATCTGG - Intergenic
1172947201 20:38698786-38698808 GACTTCCACCCCTCTGGATCAGG + Intergenic
1173276253 20:41586281-41586303 GACTTTCACCCCTCCGGATCCGG + Intronic
1174299499 20:49571221-49571243 GACATCCAACCCTCTGGCTATGG + Intergenic
1177263006 21:18753084-18753106 GACTCCCATCCCTCCGGATCCGG - Intergenic
1177263973 21:18760111-18760133 GACTCCCATCCCTCCGGATCCGG - Intergenic
1177359354 21:20048608-20048630 GACTTCCACCCCTCCGGATCCGG - Intergenic
1177531189 21:22360108-22360130 GACTGCCATCCCTCCAGATCTGG - Intergenic
1177738130 21:25118817-25118839 GACTTCCACCCCTCCGGATCCGG + Intergenic
1177895737 21:26854852-26854874 GACTTCCATCCCTCTAGATCTGG + Intergenic
1177896709 21:26861686-26861708 GACTTCCATCCCTCCAGATCTGG + Intergenic
1179259605 21:39746235-39746257 GACTTCCATTCCTCCAGATCCGG - Exonic
1179444718 21:41423201-41423223 GATGTCCACCCCTCTGGATCCGG - Intronic
1179606326 21:42517873-42517895 CAGTTCCACCCCTATGGACCAGG - Intronic
1184175845 22:42788332-42788354 GTCTTCCAACCCACTGGCTCAGG + Intergenic
949231536 3:1756535-1756557 GGCATCCTCCCCTCTGGGTCTGG - Intergenic
951201169 3:19876432-19876454 GATTCCCATCCCTCTGAATCTGG - Intergenic
951326069 3:21303093-21303115 GACTTCCATCCCTCCAGATCCGG - Intergenic
951837649 3:27001177-27001199 GACTTCCATCCCTCCAGATCTGG + Intergenic
951915162 3:27793005-27793027 GACTTCCCTCCCTCTGGCTCAGG - Intergenic
952921710 3:38289740-38289762 GACTTCCACCCCTCCGGATCTGG - Intronic
952922692 3:38296887-38296909 GACTTCCACCCCTCCGAATCTGG - Intronic
953037439 3:39225370-39225392 GACTTCCATCCCCCTGGACAGGG - Intergenic
953515828 3:43591229-43591251 GACTTCCATCCCTCCAGATCAGG + Intronic
954096963 3:48336059-48336081 GGCTTCCACACCTCCGGATTGGG - Intergenic
955381271 3:58440182-58440204 GACTTCCACCCCTCTGGATCCGG - Intergenic
955772866 3:62403967-62403989 GACTGCCACCCCTGTGGTGCAGG + Intronic
956564247 3:70617524-70617546 GACTTCCATCCCTCCAGATCTGG + Intergenic
957000501 3:74877903-74877925 GACTTCCATCCCTCCGGATCCGG - Intergenic
957687048 3:83515329-83515351 GACTTCCATCCCTCCGGATGCGG + Intergenic
957895112 3:86411998-86412020 GGCTTCCACCCTTCTGGATCCGG + Intergenic
958016741 3:87946197-87946219 GACTTCCACCCCTCTGGATCCGG - Intergenic
958091890 3:88886798-88886820 GACTTCCACCCCTCTGGATCCGG - Intergenic
958424508 3:93965312-93965334 GACTCCCATCCCTCCGGATCCGG + Intronic
958629242 3:96666792-96666814 GACTACCATCCCTCTGGATCCGG - Intergenic
958630363 3:96675010-96675032 GACTTACATCCCTCCGGATCTGG - Intergenic
958794445 3:98692064-98692086 GTTTTCCACACCTCTTGATCAGG + Intergenic
959406347 3:105966203-105966225 GACTTCCACCCTTCCAGATCCGG + Intergenic
959446564 3:106447748-106447770 AACTTTCAGCCCTCTGGCTCTGG + Intergenic
959885714 3:111497362-111497384 GACTTTCATCCCTCTGGATTTGG - Intronic
961897470 3:130180636-130180658 GACTTACACCCCTTTTGACCCGG - Intergenic
962492674 3:135909408-135909430 AACTTCCACCTCTCCGGTTCAGG + Intergenic
962745468 3:138394703-138394725 GACTTCCCCACCTCAGCATCTGG + Intronic
963255686 3:143142526-143142548 GACTTCCACCCCTCCGGATCCGG + Intergenic
963575890 3:147060191-147060213 GACTTCCATCCCTCCAGATCTGG + Intergenic
963915316 3:150854412-150854434 GACTTCCATCCCTCTGGATCTGG + Intergenic
965054288 3:163694797-163694819 GACTGTCACTCCTCTGGATCAGG - Intergenic
965342128 3:167503668-167503690 GACTTCCATCCCTCTGGATCTGG - Intronic
966511218 3:180765634-180765656 GACTTTCACCCCTCCGGATCCGG - Intronic
966994311 3:185265054-185265076 GACTCCCACCCCTCCGGATCCGG + Intronic
969007637 4:4034208-4034230 GATTTACACCCCTTTGGACCCGG - Intergenic
969745971 4:9071855-9071877 GACTTACACCCCTTTTGACCCGG + Intergenic
969805334 4:9603284-9603306 GATTTACACCCCTTTTGATCCGG + Intergenic
969814183 4:9674475-9674497 GACCTTCACCCTTCTGTATCAGG - Intergenic
970095532 4:12459587-12459609 GACTTCCATCCCTGCGGATCCGG + Intergenic
970406937 4:15772958-15772980 GACTCCCTCCCCTCTTGCTCTGG - Intergenic
971076782 4:23158416-23158438 TACTTCCACCCTTCCGGATCTGG + Intergenic
971245147 4:24920580-24920602 TTCATCCACCCCTCTGCATCTGG - Intronic
972766767 4:42158529-42158551 GACTTCCATCCCTCTGGATCTGG - Intergenic
972780832 4:42285710-42285732 GACTTCCACCTCTGCAGATCTGG - Intergenic
972781775 4:42292459-42292481 GACTCCCACCCCTGCGGATCTGG - Intergenic
972853845 4:43082259-43082281 GACTTCCATCCCTCCAGATCTGG + Intergenic
973205065 4:47550809-47550831 GACTTCCACCCCTGCGGATCTGG - Intronic
973245872 4:48010798-48010820 GACTTCCATCCCTCTGGATCCGG - Intronic
974190089 4:58493382-58493404 GACTTCCATCCCTCCAGATCTGG - Intergenic
974190479 4:58496513-58496535 GACTTCCACCCCTCTGGATCTGG - Intergenic
974422271 4:61692522-61692544 AACTTCCACCTCTCAGGTTCAGG + Intronic
974487846 4:62526856-62526878 GACTTCCATCCCTCTGGATCTGG - Intergenic
974519964 4:62971434-62971456 GACTTCCAGCCCTCCGGATCCGG + Intergenic
974841800 4:67307636-67307658 GACTTCCACCTCTCCAGATCCGG + Intergenic
975313222 4:72925986-72926008 GACTTCCATCCCTCTGGATCCGG - Intergenic
975314187 4:72932748-72932770 GACTTCCATCCCTCCGGATCTGG - Intergenic
976190173 4:82479754-82479776 GACTTCCACCCCTCCGGATCCGG + Intergenic
976464846 4:85355202-85355224 GACTTCCACCCCTCCGGATCTGG - Intergenic
976963616 4:91009089-91009111 GACTTCCATCCCTCCAGATCTGG - Intronic
977251325 4:94692666-94692688 GAATTCCACCCCTCTGGATCCGG + Intergenic
977556181 4:98489619-98489641 GACTTCCACCCCTCCGGATCCGG + Intronic
978587023 4:110284261-110284283 GACTTCCATCCCTCCGAATCCGG - Intergenic
979136002 4:117113858-117113880 GACTTCTATCCCTCCAGATCGGG - Intergenic
979910834 4:126363713-126363735 GACTTCCATCCCTCCAGATCTGG + Intergenic
980386298 4:132090732-132090754 GACTTCCATCCCTCTGGATCCGG - Intergenic
980443824 4:132882456-132882478 GACTTCTACCCCTCTGAATCTGG + Intergenic
980523655 4:133961754-133961776 GACTTCCACCCCTCCAGATACGG + Intergenic
980683942 4:136201408-136201430 GGCTTCCATCCTTCCGGATCTGG + Intergenic
981740763 4:147999475-147999497 GACTTCCATCCCTCCGGATCCGG + Intronic
983777800 4:171629921-171629943 GACTTCCATCCCTCTGGATCCGG + Intergenic
983871889 4:172832985-172833007 CACTTCCACCCCCATGGCTCTGG + Intronic
984516602 4:180749226-180749248 TTCTTCCACCCCTTTGAATCTGG + Intergenic
984760846 4:183361392-183361414 GCCTTCCTCCCCTCTGGAGGAGG + Intergenic
986492613 5:8307807-8307829 GACTTCCACACCTCAGGATCCGG - Intergenic
987129616 5:14848561-14848583 GACTTCCACCCCTCCAGATTCGG + Intronic
987502699 5:18733527-18733549 GACTTCCATCCCTTCGGATCCGG - Intergenic
987508231 5:18800465-18800487 GACTTCCATCCCTCCGGATCCGG + Intergenic
987719410 5:21615313-21615335 GACTTCCACCCTTCTGGATCTGG - Intergenic
987905355 5:24069408-24069430 GACTTCCACCCCTCTGGATCTGG + Intronic
987934902 5:24451250-24451272 GACTTCCACCCCTCCAGATCCGG - Intergenic
988740537 5:34064630-34064652 GACTTCCACCCCTCCAGATCCGG - Intronic
989717703 5:44483533-44483555 GACTTCCACCCCTCTGGATCCGG + Intergenic
990741379 5:58915961-58915983 GACTTCTATCCCTCTGGATCTGG + Intergenic
990892809 5:60666118-60666140 GACTTCCACCCCTCCAGATCCGG + Intronic
990905184 5:60795656-60795678 GACTTCCAACCCTCCGGATCCGG + Intronic
992293501 5:75304611-75304633 GACTTCCACCCCTCTGGATCTGG + Intergenic
993305766 5:86272980-86273002 GACTTCCATCCCTCCGGATCTGG - Intergenic
993460754 5:88177689-88177711 GACTCCCATCCCTCCAGATCTGG - Intergenic
993640755 5:90402577-90402599 GACTTCAATTCCTCTAGATCAGG + Intronic
993941851 5:94068351-94068373 GACTTCCACCCCTCCGGATCTGG - Intronic
993982342 5:94557933-94557955 AACTTCCATCCCTCTGGATCTGG + Intronic
994149840 5:96434383-96434405 GACCTCCACCCTTCTGCAGCTGG + Intergenic
995466157 5:112451134-112451156 GACTTCCATCCCTCCAGATCTGG + Intergenic
995717283 5:115092657-115092679 GACTTCCACCCCTCCGGATCTGG + Intergenic
995785076 5:115819049-115819071 GACTTCCACCCCTCCAGATCCGG - Intergenic
996128277 5:119751566-119751588 GACTTCCATCCCTCCAGATCCGG + Intergenic
996774556 5:127119811-127119833 GAATTCCATGCCTGTGGATCAGG - Intergenic
998665969 5:144297976-144297998 GACTTTCATCCCTCTGGATTCGG + Intronic
999429196 5:151511457-151511479 GACTTCCACCCCTGGGTGTCGGG + Intronic
999875504 5:155801283-155801305 TCCTACCACCCCTCTGCATCTGG + Intergenic
1000095457 5:157967411-157967433 GACTTCCATCCCTCCGGAACCGG + Intergenic
1001597151 5:172905657-172905679 GACTTCCACCCCTCTGGATCCGG - Intronic
1002018152 5:176342516-176342538 GACTTCCCAGCCTCTGGAACTGG - Intronic
1004256417 6:14068849-14068871 GACTTCCATCCCTCCGGATCTGG + Intergenic
1005162778 6:22883756-22883778 GGCTACCACCCCTCCAGATCTGG + Intergenic
1006066206 6:31464164-31464186 CACTTCCACCCCTTGGTATCTGG + Intergenic
1007011958 6:38426564-38426586 GACTTCCATTCTTCCGGATCCGG + Intronic
1007519658 6:42441799-42441821 GTCTTTCACCCCTCTGGACTGGG - Intronic
1009519543 6:64664033-64664055 TACTTCCATCCCTCCAGATCGGG - Intronic
1009544326 6:65005151-65005173 GACTTCCATCCCTTGAGATCTGG + Intronic
1009885211 6:69617066-69617088 GACTTCAACCCCTCTGGATCTGG + Intergenic
1010424929 6:75719031-75719053 AACTTCCACCTCCCTGGCTCAGG + Intergenic
1010895033 6:81351519-81351541 GACTTCCATTCTTCCGGATCTGG + Intergenic
1011189082 6:84712026-84712048 GACTTCCACCCCTCTGGATCTGG - Intronic
1011190316 6:84720713-84720735 GACTTCCACCCCTCTGGATCTGG - Intronic
1011540387 6:88421318-88421340 GACACCCATCCCTCTGAATCCGG - Intergenic
1012734535 6:102921661-102921683 GACTTCCATCCCTCCGGATCTGG - Intergenic
1013410512 6:109879641-109879663 GACTTCCACCCCTCTGGATCTGG + Intergenic
1013543079 6:111131179-111131201 GACTTCCACCCCTCTGGATCCGG + Intronic
1014208917 6:118687794-118687816 GACTTCCATCCCTCCAGATCTGG + Intronic
1014243345 6:119041699-119041721 GACTTCCACCCCTCCGGATCCGG + Intronic
1016343645 6:143087526-143087548 GACTTCCATCCCTCTGGATCTGG - Intronic
1017869001 6:158470204-158470226 GACTCCCATCCCTCCGAATCTGG - Intronic
1017946955 6:159103869-159103891 GCCTTCCTCTCTTCTGGATCTGG + Intergenic
1018740933 6:166728188-166728210 TACAGCCACCCCTCTGCATCTGG - Intronic
1019032218 6:169023662-169023684 GAGTTCCGCAGCTCTGGATCTGG - Intergenic
1020906212 7:14067252-14067274 GACTTCCATCCCTCCAGATCTGG + Intergenic
1021144257 7:17065942-17065964 GCCATCCACCCCTCCAGATCGGG + Intergenic
1023282928 7:38590343-38590365 GACTTCTACCCCTCCAGATCTGG - Intronic
1023438997 7:40167780-40167802 GACTTCCACCCCTCCAGATCTGG - Intronic
1023439768 7:40173326-40173348 GACTTCCACCCCTCCGGATCTGG - Intronic
1023733131 7:43210802-43210824 GACTTCCACCCCTCTGGATCTGG - Intronic
1024318646 7:48044190-48044212 AATTTCCACCTCTCCGGATCCGG - Intronic
1024574247 7:50751138-50751160 CACTCCTACCCCTCTGTATCAGG + Intronic
1025716573 7:63962597-63962619 GACTCCCATCCCTCCAGATCCGG - Intergenic
1026346975 7:69482847-69482869 GACTTCCACCCCTCCAGATCCGG + Intergenic
1027858764 7:83547966-83547988 CAAGTTCACCCCTCTGGATCTGG - Intronic
1027868359 7:83675034-83675056 GACTTCCATACCTCCGGATCCGG - Intergenic
1028298666 7:89169138-89169160 GACTTTCACTCCTCCGGATGGGG - Intronic
1028926146 7:96358681-96358703 GACTTCCACCCCTCTGGATCCGG - Intergenic
1029015975 7:97315973-97315995 GACTTCCATCCCTCTGGATCTGG + Intergenic
1030208390 7:106972737-106972759 GACTTTCACCCCTCCGGATCCGG - Intergenic
1030336812 7:108337446-108337468 GACTTCCATCCCTCTGGATCTGG + Intronic
1030843976 7:114386119-114386141 GACTCCCATCCCTCTGGATCCGG - Intronic
1031250871 7:119378914-119378936 GACTTCCACCCCTCTGGATCCGG - Intergenic
1031299578 7:120047506-120047528 GCCTTCCATCCCTCCAGATCCGG + Intergenic
1031742821 7:125455903-125455925 GACTTCCATCCCTCCGGATCCGG - Intergenic
1032425787 7:131821162-131821184 GACTCCCACCCCTCTGGATCCGG - Intergenic
1032653848 7:133906726-133906748 GACTTCCATCCCTCCAGATCCGG + Intronic
1032725346 7:134585839-134585861 GACTTCCACCTCTCTGGATCAGG + Intergenic
1034248772 7:149671737-149671759 GACTTCCACCCCTCTGGATCTGG + Intergenic
1034650839 7:152688825-152688847 GACTTCCATCCCTCCGGATCCGG - Intergenic
1034707073 7:153155168-153155190 GACTTCCACCCCTCTGGATTTGG - Intergenic
1034991394 7:155549998-155550020 TACTCCCACCCCTGTTGATCCGG - Intergenic
1037570608 8:20154876-20154898 GACTTCCACCCCTCCAGATCTGG + Intronic
1037655986 8:20884645-20884667 GACTTCCAGAGCTCTGGTTCTGG - Intergenic
1038742246 8:30225906-30225928 GACTTCCATCCCTCTGGATCCGG - Intergenic
1040975375 8:53188179-53188201 GACTTTCACCACTCTAGATACGG - Intergenic
1041664089 8:60425336-60425358 GACTTCCACCCCTCGGGATCCGG - Intergenic
1042292932 8:67188695-67188717 GACTTCCACCCCTCCGGATCTGG + Intronic
1044988287 8:97774161-97774183 GACTTCCACCCCTCTGGATCCGG - Intergenic
1045657594 8:104403156-104403178 GACTTCCATCTCTCCAGATCTGG + Intronic
1045863511 8:106839354-106839376 GACTCCCACCCCTCAGGATCCGG - Intergenic
1047276657 8:123410803-123410825 GACTTCTATCCCTCCAGATCCGG + Intronic
1047443556 8:124900105-124900127 GACTTTCACCCCTCTGGATCTGG - Intergenic
1047444443 8:124906784-124906806 GACTTTCACCCCTCCAGATCTGG - Intergenic
1047599741 8:126413930-126413952 GACTTCCACCCCTCCAGATCCGG - Intergenic
1047618317 8:126581363-126581385 GACTTCCACCCCTCCGGATCTGG + Intergenic
1048100253 8:131343190-131343212 GACTTCCACCCTTCTGGATCCGG - Intergenic
1048272126 8:133037895-133037917 GACTTCCACCCATATGGCTTTGG + Exonic
1048631497 8:136247687-136247709 GACTTCCACCCCTCTGGATCTGG + Intergenic
1049433636 8:142576436-142576458 GACTCCAAGCCCTCTGGATCTGG - Intergenic
1050116054 9:2264565-2264587 GACTTCCACCCCTCCGGATCCGG - Intergenic
1050593505 9:7183583-7183605 GACTTCCATCCCTCTGGATCAGG + Intergenic
1051870080 9:21727303-21727325 GACTTCCATCCCTTCAGATCCGG + Intergenic
1053134330 9:35640625-35640647 GACTCCCATCCCTCCAGATCCGG - Intronic
1053215197 9:36265051-36265073 GACTTCCACCCCTCCGGATCTGG + Intronic
1055049591 9:71964996-71965018 GACTTCCATCCCTCTGGATCCGG - Intronic
1055431338 9:76247182-76247204 GACTTCCATCCCTCCAGATCAGG - Intronic
1055455701 9:76469647-76469669 GACTTCCATCCCTCTGGATCAGG + Intronic
1055789835 9:79911921-79911943 GACTTCCCCACCTCCGGATCAGG - Intergenic
1056705008 9:88944241-88944263 GACTTCCATCCCTCTGGATCTGG - Intergenic
1058762438 9:108147971-108147993 GGCTTCCTACTCTCTGGATCAGG - Intergenic
1060960723 9:127678803-127678825 CACTTGGACCCCTCTGGATGCGG - Intronic
1061079891 9:128363662-128363684 GACTTCCAGCCCTCTACATGTGG - Intergenic
1185560917 X:1060114-1060136 GAGTTCCACCCCTCCGGATCAGG + Intergenic
1186254531 X:7703885-7703907 GACTTCCATCCCTCTGGATCCGG - Intergenic
1189274925 X:39778692-39778714 TACTGCCACCACTCTGGTTCTGG - Intergenic
1189700722 X:43714905-43714927 GACATCCACCCTTCTGGTTTGGG - Intronic
1189954271 X:46261961-46261983 GACTTCCATCCCTCCGGATCTGG - Intergenic
1190240565 X:48654942-48654964 GACTTCCATCCCTCCAGATCCGG + Intergenic
1191167481 X:57405520-57405542 TACTTCCACCACTCTGGATCTGG - Intronic
1192254880 X:69448019-69448041 GACTTCCACCCCTCCAGATCTGG + Intergenic
1192571979 X:72213580-72213602 GACTTCCACCCCTCCAGATATGG + Intronic
1192803104 X:74485844-74485866 GACTTCCACCCCTCCGGATCCGG - Intronic
1193295489 X:79827528-79827550 GACTTCCATCCCTCCGGATATGG - Intergenic
1194154500 X:90370260-90370282 GACTTCCATCTCTCTGGATCCGG - Intergenic
1194445395 X:93981452-93981474 GACTTCCATCACTCCGGATCCGG - Intergenic
1195505077 X:105647195-105647217 GGCTTCCACCCCTCCGGATCTGG - Intronic
1195584609 X:106551431-106551453 GACTTCCATCCCTCTGGATCTGG + Intergenic
1196258165 X:113547163-113547185 GACTTCCATCGCTCCGGATCCGG - Intergenic
1197545322 X:127816564-127816586 GACTTCCATCCCTCCGGATCCGG - Intergenic
1197999712 X:132420307-132420329 GACTTCCACCCCTCCAGATCCGG - Intronic
1198566835 X:137913871-137913893 GACTTCCATCCCTCCAGATCCGG - Intergenic
1199268781 X:145858465-145858487 GACTTCCATCCCTCCAGATACGG - Intergenic
1199368812 X:147020943-147020965 GACTCCCATCCCTCCAGATCCGG + Intergenic
1199432081 X:147773207-147773229 GACTTCCATTCTTCAGGATCCGG + Intergenic
1199536306 X:148906811-148906833 GACTTCCACCCCTCCGGATCCGG + Intronic
1200500853 Y:3947153-3947175 GACTTCCATCTCTCTGGATCCGG - Intergenic
1200762687 Y:7054624-7054646 GACTTCCATCCCTCCAGATCTGG + Intronic
1201329235 Y:12800043-12800065 GACTTCCACCCCTCCAGATCTGG + Intronic
1201642241 Y:16192161-16192183 GACTTCCACCCCTCCAGATCTGG - Intergenic
1201660574 Y:16393160-16393182 GACTTCCACCCCTCCAGATCTGG + Intergenic
1201723817 Y:17132997-17133019 GACTTCCAACCCTCTGAATCTGG - Intergenic
1201724343 Y:17136694-17136716 GATTTTAACCCCTCTGGTTCTGG - Intergenic
1202062376 Y:20900863-20900885 GACTTCCATCCCTCCAGATCTGG + Intergenic