ID: 974190480

View in Genome Browser
Species Human (GRCh38)
Location 4:58496519-58496541
Sequence GCTGTTGACTTCCACCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974190480_974190486 13 Left 974190480 4:58496519-58496541 CCAGAGGGGTGGAAGTCAACAGC No data
Right 974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG No data
974190480_974190483 -7 Left 974190480 4:58496519-58496541 CCAGAGGGGTGGAAGTCAACAGC No data
Right 974190483 4:58496535-58496557 CAACAGCGGGTCTGCAACAATGG No data
974190480_974190485 9 Left 974190480 4:58496519-58496541 CCAGAGGGGTGGAAGTCAACAGC No data
Right 974190485 4:58496551-58496573 ACAATGGCGATCAGCAGTGGTGG No data
974190480_974190484 6 Left 974190480 4:58496519-58496541 CCAGAGGGGTGGAAGTCAACAGC No data
Right 974190484 4:58496548-58496570 GCAACAATGGCGATCAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974190480 Original CRISPR GCTGTTGACTTCCACCCCTC TGG (reversed) Intergenic
No off target data available for this crispr