ID: 974190483

View in Genome Browser
Species Human (GRCh38)
Location 4:58496535-58496557
Sequence CAACAGCGGGTCTGCAACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974190477_974190483 3 Left 974190477 4:58496509-58496531 CCCGCCAGATCCAGAGGGGTGGA 0: 10
1: 48
2: 85
3: 148
4: 393
Right 974190483 4:58496535-58496557 CAACAGCGGGTCTGCAACAATGG No data
974190471_974190483 29 Left 974190471 4:58496483-58496505 CCCTAGATCAGAAACGCAGCAGA No data
Right 974190483 4:58496535-58496557 CAACAGCGGGTCTGCAACAATGG No data
974190479_974190483 -1 Left 974190479 4:58496513-58496535 CCAGATCCAGAGGGGTGGAAGTC 0: 28
1: 72
2: 82
3: 94
4: 145
Right 974190483 4:58496535-58496557 CAACAGCGGGTCTGCAACAATGG No data
974190480_974190483 -7 Left 974190480 4:58496519-58496541 CCAGAGGGGTGGAAGTCAACAGC No data
Right 974190483 4:58496535-58496557 CAACAGCGGGTCTGCAACAATGG No data
974190478_974190483 2 Left 974190478 4:58496510-58496532 CCGCCAGATCCAGAGGGGTGGAA No data
Right 974190483 4:58496535-58496557 CAACAGCGGGTCTGCAACAATGG No data
974190472_974190483 28 Left 974190472 4:58496484-58496506 CCTAGATCAGAAACGCAGCAGAC No data
Right 974190483 4:58496535-58496557 CAACAGCGGGTCTGCAACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974190483 Original CRISPR CAACAGCGGGTCTGCAACAA TGG Intergenic
No off target data available for this crispr