ID: 974190486

View in Genome Browser
Species Human (GRCh38)
Location 4:58496555-58496577
Sequence TGGCGATCAGCAGTGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974190477_974190486 23 Left 974190477 4:58496509-58496531 CCCGCCAGATCCAGAGGGGTGGA 0: 10
1: 48
2: 85
3: 148
4: 393
Right 974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG No data
974190479_974190486 19 Left 974190479 4:58496513-58496535 CCAGATCCAGAGGGGTGGAAGTC 0: 28
1: 72
2: 82
3: 94
4: 145
Right 974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG No data
974190478_974190486 22 Left 974190478 4:58496510-58496532 CCGCCAGATCCAGAGGGGTGGAA No data
Right 974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG No data
974190480_974190486 13 Left 974190480 4:58496519-58496541 CCAGAGGGGTGGAAGTCAACAGC No data
Right 974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974190486 Original CRISPR TGGCGATCAGCAGTGGTGGA CGG Intergenic
No off target data available for this crispr