ID: 974194460

View in Genome Browser
Species Human (GRCh38)
Location 4:58554038-58554060
Sequence ATCTATAACCTAAAGCATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974194460_974194463 30 Left 974194460 4:58554038-58554060 CCAACATGCTTTAGGTTATAGAT No data
Right 974194463 4:58554091-58554113 TCCCTCCTCTACCCCACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974194460 Original CRISPR ATCTATAACCTAAAGCATGT TGG (reversed) Intergenic
No off target data available for this crispr