ID: 974199927

View in Genome Browser
Species Human (GRCh38)
Location 4:58623953-58623975
Sequence CAGCTGGTATGAAGCCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974199923_974199927 10 Left 974199923 4:58623920-58623942 CCAGGAGACAAGCAAAGTGGTGG No data
Right 974199927 4:58623953-58623975 CAGCTGGTATGAAGCCCAGAAGG No data
974199921_974199927 12 Left 974199921 4:58623918-58623940 CCCCAGGAGACAAGCAAAGTGGT 0: 6
1: 17
2: 8
3: 30
4: 185
Right 974199927 4:58623953-58623975 CAGCTGGTATGAAGCCCAGAAGG No data
974199919_974199927 13 Left 974199919 4:58623917-58623939 CCCCCAGGAGACAAGCAAAGTGG 0: 5
1: 19
2: 8
3: 33
4: 251
Right 974199927 4:58623953-58623975 CAGCTGGTATGAAGCCCAGAAGG No data
974199922_974199927 11 Left 974199922 4:58623919-58623941 CCCAGGAGACAAGCAAAGTGGTG 0: 9
1: 25
2: 14
3: 23
4: 201
Right 974199927 4:58623953-58623975 CAGCTGGTATGAAGCCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974199927 Original CRISPR CAGCTGGTATGAAGCCCAGA AGG Intergenic
No off target data available for this crispr