ID: 974202077

View in Genome Browser
Species Human (GRCh38)
Location 4:58655530-58655552
Sequence CATAGAAAACAAGAGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974202077_974202080 -10 Left 974202077 4:58655530-58655552 CCTCCATCCTCTTGTTTTCTATG No data
Right 974202080 4:58655543-58655565 GTTTTCTATGTGATATTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974202077 Original CRISPR CATAGAAAACAAGAGGATGG AGG (reversed) Intergenic
No off target data available for this crispr